Index Catalog // ScholarsArchive@OSU

Development of mucosal vaccines for avian influenza A virus composed of recombinant Lactococcus lactis and Streptococcus gordonii

Creator:: Reese, Kaleb A.
Abstract:: Novel mucosal vaccines (LL-M2e, LL-HAe, SG-HAe) were constructed from live, non-pathogenic Lactococcus lactis or Streptococcus gordonii that express conserved regions of HA or M2 antigens from avian influenza virus (AIV) A. All three vaccines evoked antigen-specific serum immunoglobulin G (IgG) responses in vaccinated chickens. The addition of the adjuvant cholera...
Resource Type:: Masters Thesis
Full Text:: Novel mucosal vaccines (LL-M2e, LL-HAe, SG-HAe) were constructed from live, non-pathogenic Lactococcus

Detection and transmission of Mycobacterium marinum and Mycobacterium chelonae in zebrafish (Danio rerio)

Creator:: Peterson, Tracy Shawn
Abstract:: Mycobacteriosis is a common disease of laboratory zebrafish (Danio rerio). Different infection patterns occur in zebrafish depending on mycobacterial species. Mycobacterium marinum and M. haemophilum produce virulent infections associated with high mortality, whereas M. chelonae is more wide spread and not associated with high mortality. Identification of mycobacterial infections to...
Resource Type:: Dissertation
Full Text:: (exposed at 21 days post hatch) showed 31% incidence (14/45). Adult fish fed gelatin diets containing

Genetic mapping and physiological characterization of RNA polymerase mutants of Bacillus subtilis

Creator:: Haworth, Stephen Randall
Resource Type:: Dissertation
Full Text:: Erlenmeyer flask which contained either one ml of 31 spent SG medium or one ml of rifampin or

Roles of brca2 (fancd1) in Oocyte Nuclear Architecture, Gametogenesis, Gonad Tumors, and Genome Stability in Zebrafish

Creator:: Rodriguez-Mari, Adriana, Wilson, Catherine, Titus, Tom A., Canestro, Cristian, BreMiller, Ruth A., Yan, Yi-Lin, Nanda, Indrajit, Johnston, Adam, Kanki, John P., Gray, Erin M., He, Xinjun, Spitsbergen, Jan, Schindler, Detlev, and Postlethwait, John H.
Abstract:: Mild mutations in BRCA2 (FANCD1) cause Fanconi anemia (FA) when homozygous, while severe mutations cause common cancers including breast, ovarian, and prostate cancers when heterozygous. Here we report a zebrafish brca2 insertional mutant that shares phenotypes with human patients and identifies a novel brca2 function in oogenesis. Experiments showed that...
Resource Type:: Article
Full Text:: August 3, 2010; Accepted February 28, 2011; Published March 31, 2011 Copyright: � 2011 Rodrı́guez-Marı́

The rpsL gene and streptomycin resistance in Streptococcus gordonii and Streptococcus pyogenes

Creator:: Vidyasanker, Radhika
Abstract:: Streptomycin resistance in both gram-positive and gram-negative bacteria is usually caused by a single mutation in the rpsL gene. The rpsL gene encodes the S12 protein of the ribosomal complex. The rpsL genes of various bacteria have consensus regions in their sequences. Primers were designed from these consensus pockets and...
Resource Type:: Masters Thesis
Full Text:: the Appendix. 31 CT CGT GT AGGAACAAT GACACCTAAAAAACCTAACT CTGCCCT TCGTAAAT T TGCTCGTGTACGTT

Human health significance of vibrios from the aquatic environment

Creator:: Nishibuchi, Mitsuaki
Abstract:: For the enrichment and enumeration of Vibrio fluvialis, a broth medium was designed by modifying alkaline peptone (AP) medium. This new V. fluvialis enrichment medium (FEM) was shown to be more effective than AP medium in field samplings where a total of 177 samples (estuarine waters and sediment, sewage, and...
Resource Type:: Dissertation
Full Text:: is not clear (11). A species named V. vulnificus was established by Farmer (31) in 1980. It

Differential agar media for the identification of the Salmonella and Arizona groups of Enterobacteriaceae

Creator:: Stroup, John Raymond
Abstract:: Twelve differential agars have been studied in the development of media to presumptively identify the Salmonella Subgenera I-IV. Medium No. 7B/A (or Medium No. 7-H₂S Strip) combined the malonate, dulcitol, lysine decarboxylase and hydrogen sulfide reactions in one tube. It was designed to be used at the TSI stage of...
Resource Type:: Masters Thesis
Full Text:: 29 29 31 31 34 34 38 38 40 40 42 42 45 DIFFERENTIAL AGAR MEDIA FOR THE IDENTIFICATION

Molecular characterization of the proteinase and RNA-dependent RNA polymerase of Infectious Pancreatic Necrosis Virus, a fish birnavirus

Creator:: Mason, Carla L.
Abstract:: The A segment of infectious pancreatic necrosis virus (IPNV) is expressed as a polyprotein encoding three primary gene products, VP2, NS and VP3, from a large open reading frame. The nucleotide sequence for the A segment of the Sp isolate of IPNV was determined. The NS protein is the putative...
Resource Type:: Dissertation
Full Text:: proteins pVP2 (63 kDa) and VP3 (31 kDa), as well as the non-structural protein NS (28.5 kDa) (Huang et al

The Genome of Pseudomonas fluorescens Strain R124 Demonstrates Phenotypic Adaptation to the Mineral Environment

Creator:: Barton, Michael D., Petronio, Michael, Giarrizzo, Juan G., Bowling, Bethany V., and Barton, Hazel A.
Abstract:: Microbial adaptation to environmental conditions is a complex process, including acquisition of positive traits through horizontal gene transfer or the modification of existing genes through duplication and/or mutation. In this study, we examined the adaptation of a Pseudomonas fluorescens isolate (R124) from the nutrient-limited mineral environment of a silica cave...
Resource Type:: Article
Full Text:: tetranucleotide variance (30, 31). A generalized extreme value dis- tribution was used to select the HGT regions

Metagenomics: Microbial diversity through a scratched lens

Creator:: Temperton, Ben and Giovannoni, Stephen J.
Abstract:: Since nucleic acids were first extracted directly from the environment and sequenced, metagenomics has grown to one of the most data-rich and pervasive techniques for understanding the taxonomic and functional diversity of microbial communities. In the last decade, cheaper sequencing has democratized the application of metagenomics and generated billions of...
Resource Type:: Article
Full Text:: 31 ‘metagenomics’ was coined [5] and this exciting new field hinted at the scale of 32 genetic

ScholarsArchive@OSU

Development of mucosal vaccines for avian influenza A virus composed of recombinant Lactococcus lactis and Streptococcus gordonii

Detection and transmission of Mycobacterium marinum and Mycobacterium chelonae in zebrafish (Danio rerio)

Genetic mapping and physiological characterization of RNA polymerase mutants of Bacillus subtilis

Roles of brca2 (fancd1) in Oocyte Nuclear Architecture, Gametogenesis, Gonad Tumors, and Genome Stability in Zebrafish

The rpsL gene and streptomycin resistance in Streptococcus gordonii and Streptococcus pyogenes

Human health significance of vibrios from the aquatic environment

Differential agar media for the identification of the Salmonella and Arizona groups of Enterobacteriaceae

Molecular characterization of the proteinase and RNA-dependent RNA polymerase of Infectious Pancreatic Necrosis Virus, a fish birnavirus

The Genome of Pseudomonas fluorescens Strain R124 Demonstrates Phenotypic Adaptation to the Mineral Environment

Metagenomics: Microbial diversity through a scratched lens

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search