Index Catalog // ScholarsArchive@OSU

Morphologic, molecular and antigenic characteristics of Bacteroides nodosus

Creator:: Gradin, Joseph Lloyd
Resource Type:: Dissertation
Full Text:: Bactt.!idel'' sus Pili Abstract approved: Redacted for privacy Alvin W. Smith V Bacteroides nodosus is

The lipids of spore types B, E, and F and vegetative cell types E and F of Clostridium botulinum

Creator:: Kimble, Charles E.
Abstract:: The primary purpose of this investigation was to characterize the lipids of the spores and vegetative cells of Cl. botulinum. A second purpose was to explore the possibility that lipids might serve as a means of differentiating the chiefly proteolytic Cl. botulinum type B from the nonproteolytic Cl. botulinum types...
Resource Type:: Masters Thesis
Full Text:: The Lipids of Spore Types B, E, and F and Vegetative Cell

Comparisons of calicivirus pathotypes using oligonucleotide patterns from two-dimensional gel electrophoresis

Creator:: Gambee, Jay E.
Abstract:: Six serotypes of calicivirus (San Miguel Sea Lion Virus types 4,6,7 and 13, Mink Calicivirus and Reptile Calicivirus) were plaque purified, and two-dimensional gel electrophoresis fingerprints, of the ³²P-labeled Ribonuclease T1 digested viral RNA, were performed for each serotype. Fingerprints revealed several oligonucleotides with similar mobilities, and therefore, possibly similar...
Resource Type:: Masters Thesis
Full Text:: professor, Dr. Alvin W. Smith, for his helpful discussions and guidance, and for providing a place to work

Antimicrobial resistance and plasmid properties of Leuconostoc and group N Streptococcus

Creator:: Orberg, Paulo K.
Abstract:: A method for rapid isolation of plasmid DNA from group N streptococci was developed. Chief advantages of the method were simplicity, the utilization of microliter quantities of reagents, and the obtainment of preparations highly enriched for covalently closed circular plasmid DNA. The method was also applied to over 15 Leuconostoc...
Resource Type:: Dissertation
Full Text:: : William E. Sandine A method for rapid isolation of plasmid DNA from group N streptococci was developed

Sulforaphane Regulation of LncRNA in a Transplacental Nrf2 Knockout Mouse Model Exposed to Dibenzo[def,p]chrysene

Creator:: Patel, Karan A.
Abstract:: Dibenzo[def,p]chrysene (DBC) is a highly potent, but less prevalent, environmental carcinogen belonging to a class of compounds known as Polycyclic Aromatic Hydrocarbons (PAHs). They are highly ubiquitous and arise as a byproduct of natural and anthropogenic combustion processes. Previous studies have documented carcinogenic effects upon in utero exposure of PAHs....
Resource Type:: Honors College Thesis
Full Text:: ; muNrf2 f-tggacgggactattgaaggctg, muNrf2 r- tgtttgacacttccaggggc, Nrf2/LacZ complex r

Application of bacteriocins produced by lactic acid bacteria in preserving dairy products and development of a selective medium for Leuconostoc isolation

Creator:: Benkerroum, Noreddine
Resource Type:: Dissertation
Full Text:: : William E. Sandine Screening lactic acid bacteria for bacteriocin production against Listeria

Effects of propionibacterial metabolites on spoilage and pathogenic bacteria in dairy products

Creator:: Teo, Alex Yeow-Lim
Resource Type:: Masters Thesis
Full Text:: Metabolites On Spoilage and Pathogenic Bacteria in Dairy Products Abstract approved by: William E. Sandine

Properties of Pseudomonas aeruginosa resistant to quaternary ammonium compound

Creator:: Washam, Clinton Jay
Abstract:: Pseudomonas aeruginosa cells were selected for their ability to grow in the presence of 750 ppm alkyldimethylethylbenzyl ammonium chloride (QAC). These cells were found to retain their resistance to the germicide throughout tri-weekly transfers for 7 months in tryptone glucose yeast extract (TGY) broth containing no QAC. Comparisons of the...
Resource Type:: Dissertation
Full Text:: William E. Sandine Pseudomonas aeruginosa cells were selected for their ability to grow in the

Cloning and biochemical characterization of the hectochlorin biosynthetic gene cluster from the marine cyanobacterium Lyngbya majuscula

Creator:: Ramaswamy, Aishwarya V.
Abstract:: Cyanobacteria are rich in biologically active secondary metabolites, many of which have potential application as anticancer or antimicrobial drugs or as useful probes in cell biology studies. A Jamaican isolate of the marine cyanobacterium, Lyngbya majuscula was the source of a novel antifungal and cytotoxic secondary metabolite, hectochlorin. The structure...
Resource Type:: Dissertation
Full Text:: Lyngbya maluscula Abstract approved: William H. Gerwick Cyanobacteria are rich in biologically active

Lactic streptococcal agglutinins

Creator:: Salih, Mohammed Ali
Abstract:: Lactic streptococcal agglutinins are known to promote settling of starter bacteria in milk, resulting in spongy, mealy, shattered curd and sludge formation defects in cottage cheese. These agglutinins are natural antibodies secreted by lactating cows in mature milk in response to infections (mastitis) and in colostrum milk as protective antibodies...
Resource Type:: Masters Thesis
Full Text:: Chapter 1 LACTIC STREPTOCOCCAL AGGLUTININS: A REVIEW1 Mohammed Ali Salih and William E. Sandine

ScholarsArchive@OSU

Morphologic, molecular and antigenic characteristics of Bacteroides nodosus

The lipids of spore types B, E, and F and vegetative cell types E and F of Clostridium botulinum

Comparisons of calicivirus pathotypes using oligonucleotide patterns from two-dimensional gel electrophoresis

Antimicrobial resistance and plasmid properties of Leuconostoc and group N Streptococcus

Sulforaphane Regulation of LncRNA in a Transplacental Nrf2 Knockout Mouse Model Exposed to Dibenzo[def,p]chrysene

Application of bacteriocins produced by lactic acid bacteria in preserving dairy products and development of a selective medium for Leuconostoc isolation

Effects of propionibacterial metabolites on spoilage and pathogenic bacteria in dairy products

Properties of Pseudomonas aeruginosa resistant to quaternary ammonium compound

Cloning and biochemical characterization of the hectochlorin biosynthetic gene cluster from the marine cyanobacterium Lyngbya majuscula

Lactic streptococcal agglutinins

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search