Index Catalog // ScholarsArchive@OSU

The preparation of C¹⁴ labeled formaldehyde and paraformaldehyde

Creator:: Spencer, Carl Edward
Resource Type:: Masters Thesis
Full Text:: the solution became quite warm, i.e., 36°C. Furthermore, a second, uncooled scrubber of similar

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Creator:: Bernier, Jeremiah C.
Abstract:: Chinook salmon (Oncorhynchus tshawytscha) display the greatest variability of return times to freshwater of all Pacific salmon. Differential return times to freshwater have segregated populations of Chinook into two broad types or runs, fall and spring, named for the time of year in which they migrate to freshwater. Migration time...
Resource Type:: Masters Thesis
Full Text:: cytochrome c oxidase subunit III 18681 CATGACTTAGCAAGAAATGGA 0 0 18 9.09 n/a uniquely present QM (ribosomal

The success of Carl Raymond Gray scholarship students at Oregon State College

Creator:: Fuller, William Arthur, 1932-
Resource Type:: Masters Thesis
Full Text:: . The instruction is of less than college grade. A "Carl Raymond Cray Scholarship" is defined as

Change detection of land cover in a meadow landscape : the“Ranches” meadow, Silver Falls State Park, Oregon

Creator:: Anderson, Carl G.
Abstract:: From a landscape ecology perspective, meadows are often seen as landscapes in transition. Succession and change in meadows may be investigated by considering the physical and anthropogenic factors that influence the landscape through time. What is often unknown is how changes occur and how physical and anthropogenic factors contribute to...
Resource Type:: Capstone Project
Full Text:: : Carl Anderson 2007 22 Fi gu re 4 .2 - C lim og ra ph fo r T 8S R 1E

Measurements of atmospheric sodium abundance by direct absorption of sunlight

Creator:: El Tayyan, Ahmed Asad
Abstract:: The atmospheric sodium daytime abundance was measured for Corvallis, Oregon, using direct absorption of sunlight by atmospheric sodium atoms, as observed with an optical waveguide spectrum analyzer. The disadvantage of the spectrum analyzer is that it can't resolve the sodium D-lines (Its resolving power is 0.5 nm, which is approximately...
Resource Type:: Masters Thesis
Full Text:: thank Dr. K. Krane for his support and kindness. Also I would like to thank Dr. Carl Kocher for being a

Estimating Lime Requirement for Oregon Soils with Non-Hazardous Soil Test Methods

Creator:: Makepeace, Carl A.
Abstract:: Various soil tests are routinely used in the United States to predict soil lime requirement. New non-hazardous methods have recently been proposed for adoption in Oregon, however the accuracy of these methods for Oregon soils has not been established. The objectives of this investigation were: (a) to document and describe...
Resource Type:: Masters Thesis
Full Text:: AN ABSTRACT OF THE THESIS OF Carl A

A system for analyzing and characterizing environmental chemicals and explosives and a propoasal for its miniaturization

Creator:: Sonnen, Steven J.
Abstract:: Electron capture negative ion mass spectroscopy (ECNIMS) has been performed on environmental chemicals and explosives. A trochoidal electron monochromator interfaced to a gas chromatograph and a quadrupole mass spectrometer allows compounds to be studied by this method. The method employed here differs from standard ECNIMS in that no reagent gas...
Resource Type:: Masters Thesis
Full Text:: Miniaturization Abstract approved: Carl A. Kocher Electron capture negative ion mass spectroscopy (ECNIMS

The marine air penetration of the southern Willamette Valley and its effect upon agricultural field fires

Creator:: Sielaff, Carl Ogden
Abstract:: This research consists of two related yet distinct studies: an observational study of the surface character of the penetration of marine air into the southern Willamette Valley and a climatological study of the summertime air masses of northwestern Oregon. For the observational study, temperature and estimated wind data were gathered...
Resource Type:: Masters Thesis
Full Text:: Southern Willamette Valley and Its Effect Upon Agricultural Field Fires by Carl Ogden Sielaff A THESIS

Origin and distribution of the fish fauna of the Harney Basin, Oregon

Creator:: Bisson, Peter Andre
Abstract:: A theory of the origin and distribution of fishes in the Harney Basin is presented. Blitzen River, the hydrographically and ecologically isolated creeks, and the upland tributaries of Silvies River all contain populations derived from the basin's Pleistocene connection with Malheur River of the Snake system. Colonization of many streams...
Resource Type:: Masters Thesis
Full Text:: pectoral fin is omitted to show the boundary between "regions" a and c. 18 19 deviation and standard

Mortality threshold for juvenile Chinook salmon (Oncorhynchus tshawytscha) in an epidemiological model of Ceratomyxa shasta

Creator:: Ray, R. Adam
Abstract:: The myxozoan parasite, Ceratomyxa shasta, is the most significant pathogen of juvenile Chinook salmon (Oncorhynchus tshawytscha) in the Klamath River, CA, USA. This parasite requires two hosts - a freshwater polychaete (Manayunkia speciosa) and a salmonid - to complete its life cycle. The complex life cycle and large geographic area...
Resource Type:: Masters Thesis
Full Text:: stage, which in turn infects a salmonid host. The distribution of C. shasta is limited to certain

ScholarsArchive@OSU

The preparation of C¹⁴ labeled formaldehyde and paraformaldehyde

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

The success of Carl Raymond Gray scholarship students at Oregon State College

Change detection of land cover in a meadow landscape : the“Ranches” meadow, Silver Falls State Park, Oregon

Measurements of atmospheric sodium abundance by direct absorption of sunlight

Estimating Lime Requirement for Oregon Soils with Non-Hazardous Soil Test Methods

A system for analyzing and characterizing environmental chemicals and explosives and a propoasal for its miniaturization

The marine air penetration of the southern Willamette Valley and its effect upon agricultural field fires

Origin and distribution of the fish fauna of the Harney Basin, Oregon

Mortality threshold for juvenile Chinook salmon (Oncorhynchus tshawytscha) in an epidemiological model of Ceratomyxa shasta

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Conference Name

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Funding Body

Language

License

Location

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search