Index Catalog // ScholarsArchive@OSU

Mite and Insect Control With AC 801, 757 (MK-239) Acaracide

Creator:: Johnston, Richard L. and Alby, T.
Resource Type:: Conference Proceeding
Full Text:: INSECT CONTROL WITH AC 801,757 (MK-239) ACARICIDE. R.L. Johnston, T. Alby, Field Agriculturists American

Mite and Insect Control With AC 303, 630

Creator:: Johnston, Richard L. and Alby, T.
Resource Type:: Conference Proceeding
Full Text:: INSECT CONTROL WITH AC 303,630 R.L. Johnston, T. Alby, Field Agriculturists, American Cyanamid

Can parasites halt the invader? Mermithid nematodes parasitizing the yellow-legged Asian hornet in France

Creator:: Villemant, Claire, Zuccon, Dario, Rome, Quentin, Muller, Franck, Poinar, George O., Jr., and Justine, Jean-Lou
Abstract:: Since its introduction in France 10 years ago, the yellow-legged Asian bee-hawking hornet Vespa velutina has rapidly spread to neighboring countries (Spain, Portugal, Belgium, Italy, and Germany), becoming a new threat to beekeeping activities. While introduced species often leave behind natural enemies from their original home, which benefits them in...
Resource Type:: Article
Full Text:: two overlapping fragments. Gene Primers Annealing T Reference 18S 18S-1F TACCTGGTTGATCCTGCCAGTAG 51

Response to fenamiphos, extraction techniques and population dynamics of Pratylenchus penetrans on western Oregon red raspberry

Creator:: Lolas, Mauricio
Abstract:: The effects of fenamiphos on soil and root populations of Pratylenchus penetrans were evaluated in four red raspberry cv. Willamette fields in Northwestern Oregon. Field 1 was a silty clay loam with 53% organic matter (OM). Field 2 and 3 were silty loam soils with 3.25 and 2.55% OM, respectively...
Resource Type:: Masters Thesis
Full Text:: than in conventional plots (Alby g_t 11., 1983). However, populations of plant-parasitic nematodes

Research reports : 50th Annual Northwest Insect Management Conference

Creator:: Northwest Insect Management Conference
Abstract:: Proceedings of the 50th Annual Northwest Insect Management Conference, held January 7-8, 1991 at the Imperial Hotel in Portland, Oregon.
Resource Type:: Conference Proceeding
Full Text:: -239) ACARICIDE. R.L. Johnston, T. Alby, Field Agriculturists American Cyanamid Company, Princeton, NJ

Jointed goatgrass : outcrossing, competition with winter wheat, and response to timing and rate of imazamox

Creator:: Cannon, Joshua B.
Abstract:: Jointed goatgrass (Aegilops cylindrica Host.) is a serious weed problem in wheat (Triticum aestivum L.) production in the United States. Studies were conducted to determine the outcrossing rate, competitive ability, and effectiveness of certain control practices on jointed goatgrass. A field study was conducted over two years at four locations...
Resource Type:: Masters Thesis
Full Text:: influenced by winter wheat seeding rate. Proc. West. Soc. Weed Sci. 50:58. List, J. D., D. Thill, T

Wasco and Warm Springs Indian clothing for six periods between 1805 and 1976

Creator:: Altseimer-Tilson, Wendy Victoria
Abstract:: The purpose of this study was twofold. One purpose was to investigate the clothing worn by the adult members of the Wasco and Warm Springs Indians. Six periods of time were examined: Period I - 1805-1811 Period II - 1870's-1880's Period III - 1900-1905 Period IV - 1950's-192-0's Period 7...
Resource Type:: Masters Thesis
Full Text:: u-'' c) (Nl C\1 te\ tc 0 C- 1 I-- e - CJ CJ C\ I C\I c,,j C\I (NJ r U.) t:10 -P tr) ,4 ,1 P! g 4

Research reports : 54th Annual Northwest Insect Management Conference

Creator:: Pacific Northwest Insect Management Conference
Abstract:: Proceedings of the 54th Annual Pacific Northwest Insect Management Conference, held January 9-10, 1995 at the Imperial Hotel in Portland, Oregon.
Resource Type:: Conference Proceeding
Full Text:: Cabbageflea beetle controlin spring-planted canola, 1994 2-T- 51 Comparison offlea beetle populations ontwo

Synthetic Studies towards Highly Oxygenated Furanyl Diterpenoids

Creator:: Goswami, Subir
Abstract:: The furanyl diterpenoid family of natural products has drawn the attention of both synthetic organic chemists and pharmacologists due to their complex structural architectures and diverse biological activity. Among them, wortmannin has been most extensively studied for biological activities. All these furanyl diterpenoids consist of a highly strained naptha[1,8-bc]furan core,...
Resource Type:: Dissertation
Full Text:: . Chem. Soc. 1989, 111, 5668-5674. [3] (a) Harada, N.; Sugioka, T.; Ando, Y.; Uda, H.; Kuriki, T. J

Research reports : 53rd Annual Northwest Insect Management Conference

Creator:: Pacific Northwest Insect Management Conference
Abstract:: Proceedings of the 53rd Annual Pacific Northwest Insect Management Conference, held January 10-11, 1994 at the Imperial Hotel in Portland, Oregon.
Resource Type:: Conference Proceeding
Full Text:: -Feeding & Mining Leader: Ted Alby 12817 SE Argus Street Vancouver WA 98684 (206)896-8280 Root-Feeding

ScholarsArchive@OSU

Mite and Insect Control With AC 801, 757 (MK-239) Acaracide

Mite and Insect Control With AC 303, 630

Can parasites halt the invader? Mermithid nematodes parasitizing the yellow-legged Asian hornet in France

Response to fenamiphos, extraction techniques and population dynamics of Pratylenchus penetrans on western Oregon red raspberry

Research reports : 50th Annual Northwest Insect Management Conference

Jointed goatgrass : outcrossing, competition with winter wheat, and response to timing and rate of imazamox

Wasco and Warm Springs Indian clothing for six periods between 1805 and 1976

Research reports : 54th Annual Northwest Insect Management Conference

Synthetic Studies towards Highly Oxygenated Furanyl Diterpenoids

Research reports : 53rd Annual Northwest Insect Management Conference

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Conference Name

Conference Section/Track

Creator

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search