Index Catalog // ScholarsArchive@OSU

Analysis of Alternative Donor Breast Milk Pasteurization Techniques and Their Impact on Bile Salt-Stimulated Lipase Activity

Creator:: Victor, Ashley F.
Abstract:: While breast milk is considered the best nourishment for newborns, they have a lowered ability to digest the fat rich liquid due to decreased lipase secretion for the first few months after birth. To offset this, breast milk itself contains Bile Salt-Stimulated Lipase (BSSL) which significantly heightens fat digestion ability....
Resource Type:: Honors College Thesis
Full Text:: µL of buffer to each well. Production of p-nitrophenol was measured by monitoring absorbance at 405

Quantifying the effect of forest age in annual net forest carbon balance

Creator:: Besnard, Simon, Carvalhais, Nuno, Arain, M. Altaf, Black, Andrew, de Bruin, Sytze, Buchmann, Nina, Cescatti, Alessandro, Chen, Jiquan, Clevers, Jan G. P. W., Desai, Ankur R., Gough, Christopher M., Havrankova, Katerina, Herold, Martin, Hortnagl, Lukas, Jung, Martin, Knohl, Alexander, Kruijt, Bart, Krupkova, Lenka, Law, Beverly E., Lindroth, Anders, Noormets, Asko, Roupsard, Olivier, Steinbrecher, Rainer, Varlagin, Andrej, Vincke, Caroline, and Reichstein, Markus
Abstract:: Forests dominate carbon (C) exchanges between the terrestrial biosphere and the atmosphere on land. In the long term, the net carbon flux between forests and the atmosphere has been significantly impacted by changes in forest cover area and structure due to ecological disturbances and management activities. Current empirical approaches for...
Resource Type:: Article
Full Text:: -date, larger, and higher quality eddy-covariance (EC) dataset including 126 forest ecosystem sites. We

Microsatellite Markers for Red Drum, Sciaenops ocellatus

Creator:: Saillant, E., Cizdziel, K., O'Malley, Kathleen G., Turner, T. F., Pruett, C. L., and Gold, J. R.
Abstract:: Polymerase chain reaction (PCR) primers are reported for 68 nuclear-encoded microsatellites developed during the past several years from genomic libraries of red drum (Sciaenops ocelwtus). All68 microsatellites were tested for reproducibility and polymorphism on a sample of five to 12 red drum; 60 of the microsatellites were found to be...
Resource Type:: Article
Full Text:: Soc 405 CTTAGCCTTTTGTTTAGTTTCC (CAh2 189 56 8 5 189-217 CACACTCATGGTCACTCCTCTC Soc406

Lean Implementations in the University Classroom and Curriculum Design

Creator:: Diep, Dustin S.
Abstract:: The Lean process improvement philosophy has been proposed as a method for improving components of Higher Education (HE), including student learning outcomes; however, current lean applications to HE have focused on administrative operations or general institutional interventions. Comparatively little work has been performed applying lean to teaching. This work fills...
Resource Type:: Honors College Thesis
Full Text:: ba n Z er o de fe ct s Pe rf ec ti on R oo t C au se A na ly si s Po ka -y ok e

Complexity Increases Predictability in Allometrically Constrained Food Webs

Creator:: Iles, Alison C. and Novak, Mark
Abstract:: All ecosystems are subjected to chronic disturbances, such as harvest, pollution, and climate change. The capacity to forecast how species respond to such press perturbations is limited by our imprecise knowledge of pairwise species interaction strengths and the many direct and indirect pathways along which perturbations can propagate between species....
Resource Type:: Article
Full Text:: Proportion matching sign 1 2 3 4 5 B 21 −3 5 sp ec ie s Lo ng es t p at h le ng th in

Genome-Wide Scan and Test of Candidate Genes in the Snail Biomphalaria glabrata Reveal New Locus Influencing Resistance to Schistosoma mansoni

Creator:: Tennessen, Jacob A., Bonner, Kaitlin M., Bollmann, Stephanie R., Johnstun, Joel A., Yeh, Jan-Ying, Marine, Melanie, Tavalire, Hannah F., Bayne, Christopher J., and Blouin, Michael S.
Abstract:: Background: New strategies to combat the global scourge of schistosomiasis may be revealed by increased understanding of the mechanisms by which the obligate snail host can resist the schistosome parasite. However, few molecular markers linked to resistance have been identified and characterized in snails. Methodology/Principal Findings: Here we test six...
Resource Type:: Article
Full Text:: bmplys 10 405 J (63), K (37) sod1 1.9** [38] aif 1380 439 L (59), M (25), N (10), O (6) none none [23

Altering phytoplankton growth rates changes their value as food for microzooplankton grazers

Creator:: McBeain, Kelsey A. and Halsey, Kimberly H.
Abstract:: When microzooplankton graze phytoplankton prey, the consumed carbon is partitioned into particulates, dissolved organic carbon (DOC), and CO2. Allocation of prey carbon to these various fates has important consequences for marine ecosystem function. A 2-stage continuous culture system was used to investigate carbon allocation by microzooplankton consuming phytoplankton grown in...
Resource Type:: Article

Catalysis of Biologically Relevant Chlorination Reactions by Nicotine, and Potential Relevance to Tissue Damage

Creator:: Dolan, Brigh G.
Abstract:: This work is concerned with determining whether nicotine has a role in promoting oxidative damage in human tissue, particularly in lung tissue. This follows from recent reports of a novel lung disease found in some E-cigarette users, characterized by oxidative damage and elevated levels of neutrophils (termed “vaping disease”). It...
Resource Type:: Honors College Thesis
Full Text:: limits of neutrophilic phagosomes,[34] the adenylate energy charge (EC), defined as ([ATP] + ½[ADP

The Evolution of Scleractinian Microbial Symbionts

Creator:: McMinds, Ryan C.
Abstract:: The modern world has presented many threats to the health and stability of ecosystems worldwide. One of the most biodiverse ecosystems, coral reefs, faces particularly strong pressures, and is already declining rapidly in complexity and area. Although the stressors that affect reefs are diverse, ranging from nutrient pollution to overfishing,...
Resource Type:: Dissertation

Evaluating Temporal Consistency in Marine Biodiversity Hotspots

Creator:: Piacenza, Susan E., Thurman, Lindsey L., Barner, Allison K., Benkwitt, Cassandra E., Boersma, Kate S., Cerny-Chipman, Elizabeth B., Ingeman, Kurt E., Kindinger, Tye L., Lindsley, Amy J., Nelson, Jake, Reimer, Jessica N., Rowe, Jennifer C., Shen, Chenchen, Thompson, Kevin A., and Heppell, Selina S.
Abstract:: With the ongoing crisis of biodiversity loss and limited resources for conservation, the concept of biodiversity hotspots has been useful in determining conservation priority areas. However, there has been limited research into how temporal variability in biodiversity may influence conservation area prioritization. To address this information gap, we present an...
Resource Type:: Article
Full Text:: : 16913938 7. Gaston KJ. Global patterns in biodiversity. Nature. 2000; 405: 220–227. doi: 10.1038/35012228

ScholarsArchive@OSU

Analysis of Alternative Donor Breast Milk Pasteurization Techniques and Their Impact on Bile Salt-Stimulated Lipase Activity

Quantifying the effect of forest age in annual net forest carbon balance

Microsatellite Markers for Red Drum, Sciaenops ocellatus

Lean Implementations in the University Classroom and Curriculum Design

Complexity Increases Predictability in Allometrically Constrained Food Webs

Genome-Wide Scan and Test of Candidate Genes in the Snail Biomphalaria glabrata Reveal New Locus Influencing Resistance to Schistosoma mansoni

Altering phytoplankton growth rates changes their value as food for microzooplankton grazers

Catalysis of Biologically Relevant Chlorination Reactions by Nicotine, and Potential Relevance to Tissue Damage

The Evolution of Scleractinian Microbial Symbionts

Evaluating Temporal Consistency in Marine Biodiversity Hotspots

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search