Index Catalog // ScholarsArchive@OSU

Carl L. Anderson : life and contributions to public health and health education

Creator:: Asan, Virginia Marie
Abstract:: The purpose of this study of the life and career of Dr. Carl Leonard Anderson was to recount his professional contributions to the field of health and relate these to public health and health education. The major emphasis of this study concerned Dr. Anderson's professional life. The accomplishment of the...
Resource Type:: Dissertation
Full Text:: . 3). The Problem This was a study of the professional life and contributions of Carl Leonard

An historical review of Kolb's formulation of experiential learning theory

Creator:: Hickcox, Leslie K. (Leslie Kay), 1951-
Abstract:: The central purposes of this study were to review the historical sources of David Kolb's formulation of experiential learning theory, and to determine the effect and application of Kolb's theory and Learning Style Inventory as reflected in the literature between 1971 and 1990. It was found that Kolb based his...
Resource Type:: Dissertation
Full Text:: . A majority (61.7%) of the studies examined found that Koib's theory and LSI were useful in five

The preparation of C¹⁴ labeled formaldehyde and paraformaldehyde

Creator:: Spencer, Carl Edward
Resource Type:: Masters Thesis
Full Text:: the solution became quite warm, i.e., 36°C. Furthermore, a second, uncooled scrubber of similar

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Creator:: Bernier, Jeremiah C.
Abstract:: Chinook salmon (Oncorhynchus tshawytscha) display the greatest variability of return times to freshwater of all Pacific salmon. Differential return times to freshwater have segregated populations of Chinook into two broad types or runs, fall and spring, named for the time of year in which they migrate to freshwater. Migration time...
Resource Type:: Masters Thesis
Full Text:: cytochrome c oxidase subunit III 18681 CATGACTTAGCAAGAAATGGA 0 0 18 9.09 n/a uniquely present QM (ribosomal

The success of Carl Raymond Gray scholarship students at Oregon State College

Creator:: Fuller, William Arthur, 1932-
Resource Type:: Masters Thesis
Full Text:: . The instruction is of less than college grade. A "Carl Raymond Cray Scholarship" is defined as

Measurements of atmospheric sodium abundance by direct absorption of sunlight

Creator:: El Tayyan, Ahmed Asad
Abstract:: The atmospheric sodium daytime abundance was measured for Corvallis, Oregon, using direct absorption of sunlight by atmospheric sodium atoms, as observed with an optical waveguide spectrum analyzer. The disadvantage of the spectrum analyzer is that it can't resolve the sodium D-lines (Its resolving power is 0.5 nm, which is approximately...
Resource Type:: Masters Thesis
Full Text:: thank Dr. K. Krane for his support and kindness. Also I would like to thank Dr. Carl Kocher for being a

The use of a high-Rydberg lithium beam and a fine mesh target to probe atom-surface interactions

Creator:: Taylor, Charles Robert, 1956-
Abstract:: A new experimental technique for the study of atom-surface interactions is obtained by passing an atomic beam containing high-Rydberg states through a fine mesh target. The technique is demonstrated to be a sensitive probe of the electric fields of adsorbed dipole layers in transmission experiments in which a time-dependent beam...
Resource Type:: Dissertation
Full Text:: Privacy Carl A. Kocher A new experimental technique for the study of atom-surface interactions is

Submonolayer adsorption on a metal surface, investigated with Rydberg atoms as electric-field-sensitive probes

Creator:: McCown, Gary Edward
Abstract:: Electric fields due to adsorbates on a metal surface are studied experimentally with Rydberg atoms as probes. A beam of lithium Rydberg atoms, produced by an oven in a high-vacuum system, passes within 3μm of the surface of a metal mesh having 6μm square openings. Rydberg states with principal quantum...
Resource Type:: Dissertation
Full Text:: for Privacy Abstract approved: Carl A. Kocher Electric fields due to adsorbates on a metal surface

A system for analyzing and characterizing environmental chemicals and explosives and a propoasal for its miniaturization

Creator:: Sonnen, Steven J.
Abstract:: Electron capture negative ion mass spectroscopy (ECNIMS) has been performed on environmental chemicals and explosives. A trochoidal electron monochromator interfaced to a gas chromatograph and a quadrupole mass spectrometer allows compounds to be studied by this method. The method employed here differs from standard ECNIMS in that no reagent gas...
Resource Type:: Masters Thesis
Full Text:: Miniaturization Abstract approved: Carl A. Kocher Electron capture negative ion mass spectroscopy (ECNIMS

Collision processes of high Ryberg states in atomic lithium

Creator:: Shepard, Chester L.
Resource Type:: Dissertation
Full Text:: Redacted for Privacy Abstract approved: Carl A. Kocher A thermal beam of lithium atoms emanating from a

ScholarsArchive@OSU

Carl L. Anderson : life and contributions to public health and health education

An historical review of Kolb's formulation of experiential learning theory

The preparation of C¹⁴ labeled formaldehyde and paraformaldehyde

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

The success of Carl Raymond Gray scholarship students at Oregon State College

Measurements of atmospheric sodium abundance by direct absorption of sunlight

The use of a high-Rydberg lithium beam and a fine mesh target to probe atom-surface interactions

Submonolayer adsorption on a metal surface, investigated with Rydberg atoms as electric-field-sensitive probes

A system for analyzing and characterizing environmental chemicals and explosives and a propoasal for its miniaturization

Collision processes of high Ryberg states in atomic lithium

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Location

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search