Index Catalog // ScholarsArchive@OSU

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Creator:: Bernier, Jeremiah C.
Abstract:: Chinook salmon (Oncorhynchus tshawytscha) display the greatest variability of return times to freshwater of all Pacific salmon. Differential return times to freshwater have segregated populations of Chinook into two broad types or runs, fall and spring, named for the time of year in which they migrate to freshwater. Migration time...
Resource Type:: Masters Thesis
Full Text:: cytochrome c oxidase subunit III 18681 CATGACTTAGCAAGAAATGGA 0 0 18 9.09 n/a uniquely present QM (ribosomal

Methomyl and Honey Bees

Creator:: Mayer, Daniel F., Johansen, C. A., Shanks, Carl H., Jr., and Lunden, Jeff D.
Resource Type:: Conference Proceeding
Full Text:: HONEY BEES D.F. Mayer, CA. Johansen, C.H. Shanks and J.D. Lunden Department of Entomology, WSU-IAREC

Change detection of land cover in a meadow landscape : the“Ranches” meadow, Silver Falls State Park, Oregon

Creator:: Anderson, Carl G.
Abstract:: From a landscape ecology perspective, meadows are often seen as landscapes in transition. Succession and change in meadows may be investigated by considering the physical and anthropogenic factors that influence the landscape through time. What is often unknown is how changes occur and how physical and anthropogenic factors contribute to...
Resource Type:: Capstone Project
Full Text:: : Carl Anderson 2007 22 Fi gu re 4 .2 - C lim og ra ph fo r T 8S R 1E

Measurements of atmospheric sodium abundance by direct absorption of sunlight

Creator:: El Tayyan, Ahmed Asad
Abstract:: The atmospheric sodium daytime abundance was measured for Corvallis, Oregon, using direct absorption of sunlight by atmospheric sodium atoms, as observed with an optical waveguide spectrum analyzer. The disadvantage of the spectrum analyzer is that it can't resolve the sodium D-lines (Its resolving power is 0.5 nm, which is approximately...
Resource Type:: Masters Thesis
Full Text:: thank Dr. K. Krane for his support and kindness. Also I would like to thank Dr. Carl Kocher for being a

Estimating Lime Requirement for Oregon Soils with Non-Hazardous Soil Test Methods

Creator:: Makepeace, Carl A.
Abstract:: Various soil tests are routinely used in the United States to predict soil lime requirement. New non-hazardous methods have recently been proposed for adoption in Oregon, however the accuracy of these methods for Oregon soils has not been established. The objectives of this investigation were: (a) to document and describe...
Resource Type:: Masters Thesis
Full Text:: AN ABSTRACT OF THE THESIS OF Carl A

Quantitative determination of emerging contaminants, solvent stabilizers and fullerene nanomaterials, in biological and environmental systems

Creator:: Isaacson, Carl W.
Abstract:: To determine the impact of emerging environmental contaminants on human and environmental health, quantitative analytical methods are required. Analysis of emerging contaminants is hampered by their widely varying physical-chemical properties. Therefore quantitative analytical methods must be developed to determine the behavior of emerging contaminants in environmental systems. A quantitative analytical...
Resource Type:: Dissertation
Full Text:: Systems. by Carl W. Isaacson A DISSERTATION submitted to Oregon State University in partial

Mortality threshold for juvenile Chinook salmon (Oncorhynchus tshawytscha) in an epidemiological model of Ceratomyxa shasta

Creator:: Ray, R. Adam
Abstract:: The myxozoan parasite, Ceratomyxa shasta, is the most significant pathogen of juvenile Chinook salmon (Oncorhynchus tshawytscha) in the Klamath River, CA, USA. This parasite requires two hosts - a freshwater polychaete (Manayunkia speciosa) and a salmonid - to complete its life cycle. The complex life cycle and large geographic area...
Resource Type:: Masters Thesis
Full Text:: stage, which in turn infects a salmonid host. The distribution of C. shasta is limited to certain

Stress induced differential gene expression in the brain of juvenile steelhead trout, (Oncorhynchus Mykiss)

Creator:: Schwindt, Adam R.
Abstract:: Gene expression profiles of tissues and cell-lines can be powerful tools for documenting the genetic response to a particular treatment, such as stressors. However, there is a paucity of information on the genetic stress response in the brain. Therefore, we attempted to profile gene expression in the brain of juvenile...
Resource Type:: Masters Thesis
Full Text:: -Ann C. Leong, Wilfrido Contreras-Sánchez, and Carl B. Schreck 2 ABSTRACT We utilized suppression

Growth, residence, and movement of juvenile Chinook salmon within restored and reference estuarine marsh channels in Salmon River, Oregon

Creator:: Hering, David K.
Abstract:: Tidal wetland channels provide rearing habitat for juvenile Chinook salmon as they emigrate from freshwater habitat and prepare to enter the ocean. Widespread diking and drainage of estuarine marshes for agricultural and urban development may have contributed to a decline in salmon abundance in the Pacific Northwest, prompting efforts to...
Resource Type:: Masters Thesis
Full Text:: estuary depicting tidal wetland areas restored by dike removal in (a) 1978, (b) 1987, and (c) 1996

The effects of single and multiple pathogen and parasite infections on juvenile chinook and coho salmon during early marine residency

Creator:: Sandell, Todd A.
Abstract:: Nearly 3000 juvenile Chinook (Oncorhynchus tshawytscha) and coho (O. kisutch) salmon captured in nearshore waters off the coasts of Washington and Oregon from 1999-2004 were tested for infection by Renibacterium salmoninarum, Nanophyetus salmincola, and skin metacercariae. First, three quantitative PCR primer/probe sets were compared for detection of R. salmoninarum; amplification...
Resource Type:: Dissertation
Full Text:: THE DISSERTATION OF Todd A. Sandell for the degree of Doctor of Philosophy in Microbiology

ScholarsArchive@OSU

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Methomyl and Honey Bees

Change detection of land cover in a meadow landscape : the“Ranches” meadow, Silver Falls State Park, Oregon

Measurements of atmospheric sodium abundance by direct absorption of sunlight

Estimating Lime Requirement for Oregon Soils with Non-Hazardous Soil Test Methods

Quantitative determination of emerging contaminants, solvent stabilizers and fullerene nanomaterials, in biological and environmental systems

Mortality threshold for juvenile Chinook salmon (Oncorhynchus tshawytscha) in an epidemiological model of Ceratomyxa shasta

Stress induced differential gene expression in the brain of juvenile steelhead trout, (Oncorhynchus Mykiss)

Growth, residence, and movement of juvenile Chinook salmon within restored and reference estuarine marsh channels in Salmon River, Oregon

The effects of single and multiple pathogen and parasite infections on juvenile chinook and coho salmon during early marine residency

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Conference Name

Conference Section/Track

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Funding Body

Language

License

Location

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search