#NEXUS begin taxa; dimensions ntax=38; taxlabels CtenopomaMultispine3[&Created=Tue May 27 12:20:38 PDT 2014,Modified=Tue May 27 12:20:52 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] CtenopomaMultispine2[&Created=Tue May 27 12:15:08 PDT 2014,Modified=Tue May 27 12:15:25 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 204Verlorenvlei[&Created=Wed Sep 18 11:50:29 PDT 2013,Modified=Mon May 12 11:25:22 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 207Verlorenvlei[&Bin="<3>High",Created=Fri Jun 14 14:36:30 PDT 2013,MQ%=1.0%,Modified=Mon May 12 11:25:40 PDT 2014,Ambiguities=3,description="",Topology="linear",LQ%=0.0%,Post-Trim=691,"Molecule Type"="DNA",HQ%=99.0%] 221Verlorenvlei[&Created=Wed Sep 18 16:25:28 PDT 2013,Modified=Mon May 12 11:25:46 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 206Verlorenvlei[&Created=Wed Sep 18 15:24:28 PDT 2013,Modified=Mon May 12 11:25:34 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 205Verlorenvlei[&Created=Wed Sep 18 15:14:36 PDT 2013,Modified=Mon May 12 11:25:29 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 238Berg[&Created=Wed Sep 18 15:59:36 PDT 2013,Modified=Mon May 12 11:26:05 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 271Berg[&Bin="<3>High",Created=Fri Jun 14 14:54:58 PDT 2013,MQ%=1.3%,Modified=Mon May 12 11:26:53 PDT 2014,Ambiguities=0,description="",Topology="linear",LQ%=0.0%,Post-Trim=691,"Molecule Type"="DNA",HQ%=98.7%] 237Berg[&Created=Thu Sep 19 08:58:20 PDT 2013,Modified=Mon May 12 11:26:14 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 239Berg[&Created=Thu Sep 19 09:58:49 PDT 2013,Modified=Mon May 12 11:26:22 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 270Berg[&Created=Wed Sep 18 15:34:31 PDT 2013,Modified=Mon May 12 11:26:46 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 257Diep[&Created=Fri May 30 18:53:58 PDT 2014,Modified=Fri May 30 19:02:20 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 258Diep[&Bin="<3>High",Created=Fri Jun 14 14:45:02 PDT 2013,MQ%=1.2%,Modified=Mon May 12 11:26:31 PDT 2014,Ambiguities=1,description="",Topology="linear",LQ%=0.0%,Post-Trim=691,"Molecule Type"="DNA",HQ%=98.8%] 260Diep[&Created=Wed Sep 18 15:43:21 PDT 2013,Modified=Mon May 12 11:26:43 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 256Diep[&Created=Fri May 30 19:01:21 PDT 2014,Modified=Fri May 30 19:02:26 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 259Diep[&Created=Thu Sep 19 10:29:36 PDT 2013,Modified=Mon May 12 11:26:35 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 174Klein[&Created=Wed Sep 18 16:37:29 PDT 2013,Modified=Mon May 12 11:25:17 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 172Klein[&Created=Wed Sep 18 16:16:20 PDT 2013,Modified=Mon May 12 11:25:11 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 162Klein[&Created=Wed Sep 18 10:10:52 PDT 2013,Modified=Mon May 12 11:24:36 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 166Klein[&Created=Wed Sep 18 10:52:05 PDT 2013,Modified=Mon May 12 11:24:50 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 171Klein[&Created=Thu Sep 19 09:25:14 PDT 2013,Modified=Mon May 12 11:25:03 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 164Klein[&Created=Wed Sep 18 11:44:59 PDT 2013,Modified=Mon May 12 11:24:44 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 169Klein[&Created=Thu Sep 19 09:17:22 PDT 2013,Modified=Mon May 12 11:24:59 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 163Klein[&Created=Wed Sep 18 10:22:27 PDT 2013,Modified=Mon May 12 11:24:40 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 139Heuningnes[&Ambiguities=1,Topology="linear",LQ%=1.4%,"Failed Binning Fields"="HQ%","Molecule Type"="DNA",Bin="<2>Medium",Created=Fri Jun 14 13:59:11 PDT 2013,MQ%=11.0%,Modified=Mon May 12 11:24:18 PDT 2014,description="",Post-Trim=691,HQ%=87.6%] 140Heuningnes[&Created=Wed Sep 18 09:53:16 PDT 2013,Modified=Mon May 12 11:24:23 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 149Uilkraal[&Created=Wed Sep 18 10:02:37 PDT 2013,Modified=Mon May 12 11:24:31 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 311BreedeKoekedouw[&Created=Wed Sep 18 15:49:45 PDT 2013,Modified=Mon May 12 11:27:23 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 308BreedeWit[&Created=Thu Sep 19 10:51:49 PDT 2013,Modified=Mon May 12 11:27:10 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 286SilverSands[&Bin="<3>High",Created=Fri Jun 14 14:59:48 PDT 2013,MQ%=1.3%,Modified=Mon May 12 11:27:03 PDT 2014,Ambiguities=0,description="",Topology="linear",LQ%=0.0%,Post-Trim=691,"Molecule Type"="DNA",HQ%=98.7%] 019Gamtoos[&Created=Mon Sep 09 14:59:40 PDT 2013,Modified=Mon May 12 11:23:50 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 064Rooi[&Created=Mon Sep 09 16:26:22 PDT 2013,Modified=Mon May 12 11:24:03 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 035Bosfontein[&Created=Mon Sep 09 15:44:05 PDT 2013,Modified=Tue May 27 13:04:28 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 330GouritsInland[&Created=Wed Sep 18 16:45:56 PDT 2013,Modified=Mon May 12 11:27:30 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 115Duiwenhoks[&Created=Mon Sep 09 16:46:25 PDT 2013,Modified=Mon May 12 11:24:12 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 361Baakens[&Created=Thu Sep 19 11:44:34 PDT 2013,Modified=Mon May 12 11:27:35 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] 362Baakens[&Created=Thu Sep 19 11:59:26 PDT 2013,Modified=Mon May 12 11:28:07 PDT 2014,description="",Topology="linear","Molecule Type"="DNA"] ; end; begin characters; dimensions nchar=686; format datatype=dna missing=? gap=-; matrix CtenopomaMultispine3 CTGCCTTTTCTGTT-CAAAATGGGCTTTAATTATGTTTAATTGTTAATTTTACCCACAATAAAGCATATTAAGTATTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATTACACAAAATAAAGCGTAGTAGAGTGTCCTCGGTGAATGGGTTGTGGTGATAGGGAATAGTTAGCAGGCCGTGCATGTGTTCTCATAGCAGCGACAGGAGAAGGTGGTGGATTACTGGGTATATTAAAATCTATGTATCTGTTTTTTTTGTGTAACATAAAGTTTGTTACTGTTGGTTTATACTTAAGTTAGTGTCCAGCTAAATTAAAACCAGACATAAATGACAGCCGGCTAGTTCTGTTAGCTAGCTAGCGTTACT-----------GTTAACGTGTTCATGCTGAGCCGCAGTTTCTCTGTACGTTACGAGCTCAGCC-TTTTTTCTTTATTTTCTTAATCTAAGTTTGTGTGTTTTGTCCTCAGGAAGTAGTTTTTGCTCTAGACTATGTCGCGTTAGGTGCTAAGTGCTAGCATTGAGCTGGTTCTCCTATATACCTGTGT--------------TGCTCCTTCAGGATTCATGTTAGTAATGTGCAAAAAGATGCGAAGCTGTGTTTAACATGTAAAAGACATGTTTTTATGTCACTTTACAGAGACAAAGGCCA CtenopomaMultispine2 CTGCCTTTTCTGTT-CAAAATGGGCTTTAATTATGTTTAATTGTTAATTTTACCCACAATAAAGCATATTAAGTATTTGATACCTTAGATTATGTACTTTACGGCGGCGGATGGTTGTTTTAATTACACAAAATAAAGCGTAGTAGAGTGTCCTCGGTGAATGGGTTGTGGTGATAGGGAATAGTTAGCAGGCCGTGCATGTGTTCTCATAGCAGCGACAGGAGAAGGTGGTGGATTACTGGGTATATTAAAATCTATGTATCTG-TTTTTTTGTGTAACATAAAGTTTGTTACTGTTGGTTTATACTTAAGTTAGTGTCCAGCTAAATTAAAACCAG--ACAAATGACAGCCGGCTAGTTCTGTTAGCTAGCTAGCGTTACT-----------GTTAACGTGTTCATGCTGAGCCGCAGTTTCTCTGTACGTTACGAGCTCAGCC-TTTTTTCTTTATTTTCTTAATCTAAGTTTGTGTGTTTTGTCCTCAGGAAGTAGTTTTTGTTCTAAACTATGTCGCGTTAGGTGCTAAGTGCTAGCATTGAGCTGGTTCTCCTATATACCTGTG--------------CTGCTCCTTCAGGATTCATGTTAGTAATGTGCAAAAAGATGCGAAGCTGTGTTTAACATGTAAAAGACAAGTTTTTATGTCACTTTACAGAGACAAAGGCCA 204Verlorenvlei CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATGTTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCWAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 207Verlorenvlei CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATGTTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCWAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 221Verlorenvlei CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATGTTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCAAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 206Verlorenvlei CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATGTTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 205Verlorenvlei CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATGTTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCWAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 238Berg CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAACTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 271Berg CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAACTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 237Berg CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAACTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 239Berg CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAACTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 270Berg CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAACTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACCAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 257Diep CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGACATAAATGACAGTCGGCTAGTTATGTKAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 258Diep CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGACATAAATGACAGTCGGCTAGTTATGTKAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 260Diep CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGACATAAATGACAGTCGGCTAGTTATGTKAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 256Diep CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 259Diep CTGCCATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATAAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTATTTGCTAAATGCTAGCATTGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 174Klein CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAACTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 172Klein CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAACTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 162Klein CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAACTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 166Klein CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAACTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 171Klein CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAARATAGCATATTAASTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACYTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 164Klein CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAASTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGRCAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 169Klein CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAASTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGRCAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 163Klein CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGCGGATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACTTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGATGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 139Heuningnes CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGCGGATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 140Heuningnes CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGCGGATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACTTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGATGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 149Uilkraal CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 311BreedeKoekedouw CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGCGGATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGGTTCTC--TAAGTTACAAGCTCAGTCTTTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 308BreedeWit CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGCGGATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGGTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGCGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 286SilverSands CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGGATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 019Gamtoos CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGATAGTTCAGTCAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 064Rooi CTGCTATTTCCATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAARATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATT---ATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTRCCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 035Bosfontein CTGCTATTTCTAATAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACCCAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 330GouritsInland CTGCTATTTCTATT-AAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAGATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTGATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 115Duiwenhoks CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGCGGATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTGGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGTTGGTTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 361Baakens CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGAGAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA 362Baakens CTGCTATTTCTATTAAAAAATGGGCTTTAATTTTGTTTATTTGTTACATTTACCCACAAAATAGCATATTAAGTGTTTGATACCTTAGATTATGTAGTTTACGGCGGCGGATGGTTGTTTTAATCACACAAAATAAAGCGTAGTAGAGTATCCTCGGTGAATGGGTTGTGGTAATAGGGAAAAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGACAGGAGAAGGTTGTAGATTAATGAATATATTAATATTTATTTACTTA-ATGTTTTGTGTAAGTTTAAGTCAGTTACTGT---TTGACAGTTCAGTTAGTGTCCACCTAAATTAAAACCAGCCATAAATGACAGTCGGCTAGTTATGTTAGCCAGCTAACGTTACCGCTAAACTAAGGCTAACGTGTTCATACTGAGCCGCAGTTTCTC--TAAGTTACGAGCTCAGTC-TTTTTTCTTTACTTTCTGAATCTAAATTTGTGTGTTTTGTCTTCAGGAAGTCGTTTTTGTTCTGAA--ATGTACCGTTGTTTGCTAAATGCTAGCATGGAGCTGGTTCTCCTTTATACCTGCGTTGCTCATCTGAAGCTGCTCCTTCAGGATTCATGTCAGTAATGTGCAAGAAGATGAGAAGCTGTGTTTTACATGCAAACCGCATGTTTTTATGTCACTTTACAGAGACAAAGGCCA ; end;