Index Catalog // ScholarsArchive@OSU

Characterizing the Functional Properties of Otoferlin, Essential for Neurotransmission in Inner Hair Cells of the Cochlea

Creator:: Narayanappa, Murugesh
Abstract:: Hearing loss is one of the most common defect, affecting 360 million people worldwide due to several factors including congenital, present at or soon after birth or acquired with age. Congenital hearing loss affects 32 million children in the world. The economic impact of hearing loss is estimated to cost...
Resource Type:: Dissertation
Full Text:: Qiu, Ryan Mehl, Elisar Barbara, Pankaj Jaiswal. I am extremely grateful to everyone for helping me

Towards Resolving Functional and Evolutionary Mysteries of the Large and Heterozygous Genome of Hop (Humulus lupulus) and the Cannabaceae Family Using Genomic Data Science

Creator:: Padgitt-Cobb, Lillian K.
Abstract:: Hop (Humulus lupulus L. var. lupulus) is a diploid, dioecious plant with an extensive history of cultivation and use in brewing, as a textile, and for its therapeutic properties. Hop is prized for its ability to produce a variety of aromatic and flavor compounds, as well as compounds with anti-microbial...
Resource Type:: Dissertation
Full Text:: AN ABSTRACT OF THE DISSERTATION OF Lillian K

Age-related decrease in resilience against acute redox cycling agents: Critical role of declining GSH-dependent detoxification capacity

Creator:: Thomas, Nicholas O.
Abstract:: Over the past century, life expectancy in the United States has dramatically increased leading to an increasingly aging population with people reaching, and spending more years in ‘old age’. While this unprecedented shift in population demographics represents great strides for humanity, it is not without cost. One consequence of longer...
Resource Type:: Dissertation
Full Text:: concentrations of menadione, a vitamin K derivative and redox cycling agent, an LC50 for each age group

Age-related loss of Nrf2, a novel mechanism for the potential attenuation of xenobiotic detoxification capacity

Creator:: Smith, Eric Jonathan
Abstract:: Nuclear Factor, Erythroid Derived 2, Like 2 (NFE2L2 or Nrf2) is the primary transcription factor in cellular defense against oxidative and xenobiotic stresses in higher eukaryotes. This basic leucine zipper transcription factor regulates over 200 antioxidant, detoxification, and lipid metabolizing genes by binding to the Antioxidant Response Element (ARE; a...
Resource Type:: Dissertation

Cloning, sequencing and aflatoxin B₁ metabolism by multiple rainbow trout CYP1A cDNAs expressed in yeast

Creator:: You, Lijing
Abstract:: Previous reports indicate the presence of multiple CYP1A sequences in rainbow trout, but their functional differences are unknown. This report describes the cloning and partial characterization of four trout CYP1A cDNAs, which are given the tentative designations CYP1A1v2, v3, v4, and v5. Comparison among these four and three previously reported...
Resource Type:: Masters Thesis
Full Text:: 240PGP K PLP II ONMLE VHNN PH 241 CTCAGCCTGACTOCCATGAGCGAGCGCTACGOCTCAGTCTTCCAGATCCAAATAGGGATO 300 L S

Underlying Mechanisms of the Anti-inflammatory and Antioxidant Effects of Quercetin in Human Aortic Endothelial Cells : Implications for Vascular Inflammation and Atherosclerosis

Creator:: Li, Chuan
Abstract:: Atherosclerosis is the underlying cause of ischemic heart disease and stroke and is the leading cause of death worldwide, especially in developed countries. As an inflammatory disease of arteries in a hyperlipidemic milieu, expression of adhesion molecules, such as endothelial-leukocyte adhesion molecule-1 (E-selectin) and intercellular adhesion molecule-1 (ICAM-1), on endothelial...
Resource Type:: Dissertation

Antioxidants to enhance fertility: Role of eNOS and Potential Benefits

Creator:: Visioli, Francesco and Hagen, Tory M.
Abstract:: The use of antioxidants is now often used as a pharmacological adjunct to limit infertility. Indeed, the lay public rightly perceives oxidative stress and, thus, antioxidant treatment as important modulators of infertility. While the direct effects of antioxidant treatment on the quality of semen and oocytes are still under investigation,...
Resource Type:: Article
Full Text:: erectile dysfunction. Int J Androl 2010. (6) Polyzos NP, Mauri D, Tsappi M, Tzioras S, Kamposioras K

Antioxidant mechanisms of ascorbate and (R)-α-lipoic acid in aging and transition metal ion-mediated oxidative stress

Creator:: Shu, Jung Hyuk
Abstract:: Oxidative stress is the major driving force behind the aging process and many age-related diseases. However, direct experimental evidence of whether antioxidants, such as ascorbate (AA) and lipoic acid (LA) can slow the progression of aging process and/or reduce risks of developing degenerative disease is largely absent. This suggests a...
Resource Type:: Dissertation
Full Text:: antibodies to y-GCL. Dr. Anil K. Jaiswal contributed by providing the antibodies to Nrf2. TABLE OF

Oxidative stress in amyotrophic lateral sclerosis : the role of cellular senescence and glutathione

Creator:: Beilby, Pamela R.
Abstract:: Amyotrophic lateral sclerosis (ALS) is a devastating neurological disorder characterized by neuromuscular junction decay, motor neuron death, progressive paralysis, and eventually death of the individual, usually by respiratory failure. Oxidative stress is a prominent hallmark of the disease and is often accompanied and exacerbated by mitochondrial dysfunction and neuroinflammation. This...
Resource Type:: Dissertation

A role for ceramide accumulation in age-related cardiac mitochondrial dysfunction

Creator:: Monette, Jeffrey S.
Abstract:: Ceramides are a group of lipids in the sphingolipid family that are potent cell signaling molecules. Elevations in ceramide levels above the norm generally lead to apoptosis. Evidence from in vitro studies suggests that accumulation of ceramides within mitochondria leads to dysfunction of the mitochondria. This includes inhibition of the...
Resource Type:: Dissertation

ScholarsArchive@OSU

Characterizing the Functional Properties of Otoferlin, Essential for Neurotransmission in Inner Hair Cells of the Cochlea

Towards Resolving Functional and Evolutionary Mysteries of the Large and Heterozygous Genome of Hop (Humulus lupulus) and the Cannabaceae Family Using Genomic Data Science

Age-related decrease in resilience against acute redox cycling agents: Critical role of declining GSH-dependent detoxification capacity

Age-related loss of Nrf2, a novel mechanism for the potential attenuation of xenobiotic detoxification capacity

Cloning, sequencing and aflatoxin B₁ metabolism by multiple rainbow trout CYP1A cDNAs expressed in yeast

Underlying Mechanisms of the Anti-inflammatory and Antioxidant Effects of Quercetin in Human Aortic Endothelial Cells : Implications for Vascular Inflammation and Atherosclerosis

Antioxidants to enhance fertility: Role of eNOS and Potential Benefits

Antioxidant mechanisms of ascorbate and (R)-α-lipoic acid in aging and transition metal ion-mediated oxidative stress

Oxidative stress in amyotrophic lateral sclerosis : the role of cellular senescence and glutathione

A role for ceramide accumulation in age-related cardiac mitochondrial dysfunction

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search