Index Catalog // ScholarsArchive@OSU

Gramene: a resource for comparative grass genomics

Creator:: Ware, Doreen, Jaiswal, Pankaj, Ni, Junjian, Pan, Xiaokang, Chang, Kuan, Clark, Kenneth, Teytelman, Leonid, Schmidt, Steve, Zhao, Wei, Cartinhour, Samuel, McCouch, Susan, and Stein, Lincoln
Abstract:: Gramene (http://www.gramene.org) is a comparative genome mapping database for grasses and a community resource for rice. Rice, in addition to being an economically important crop, is also a model monocot for understanding other agronomically important grass genomes. Gramene replaces the existing AceDB database ‘RiceGenes’ with a relational database based on...
Resource Type:: Article
Full Text:: ) Comparative genetics in the grasses. Proc. Natl Acad. Sci. USA, 95, 1971–1974. 2. Tarchini,R., Biddle,P

Inoculum Reduction Measures to Manage Armillaria Root Disease in a Severely Infected Stand of Ponderosa Pine in South-Central Washington: 35-Year Results

Creator:: Shaw, Charles G., III, Omdal, D. W., Ramsey-Kroll, A., and Roth, L. F.
Abstract:: A stand of ponderosa pine (Pinus ponderosa) severely affected by Armillaria root disease was treated with five different levels of sanitation by root removal to reduce root disease losses in the regenerating stand. Treatments included the following: (1) all trees pushed over by machine, maximum removal of roots by machine...
Resource Type:: Article
Full Text:: , and treatment 4 had 80% stocking. Table 2 displays the cells that were unstocked in 2007 because of

Insights into phylogeny, sex function and age of Fragaria based on whole chloroplast genome sequencing

Creator:: Njuguna, Wambui, Liston, Aaron, Cronn, Richard, Ashman, Tia-Lynn, and Bassil, Nahla
Abstract:: The cultivated strawberry is one of the youngest domesticated plants, developed in France in the 1700s from chance hybridization between two western hemisphere octoploid species. However, little is known about the evolution of the species that gave rise to this important fruit crop. Phylogenetic analysis of chloroplast genome sequences of...
Resource Type:: Article
Full Text:: fragment pools, 203 chloroplast primers (108 for- ward, 95 reverse) were screened in various combinations

Genomic and biological analysis of Grapevine leafroll-associated virus 7 reveals a possible new genus within the family Closteroviridae

Creator:: Al Rwahnih, Maher, Doljab, Valerian V., Dauberta, Steve, Koonin, Eugene V., and Rowhani, Adib
Abstract:: Deep sequencing analysis of an asymptomatic grapevine revealed a virome containing five RNA viruses and a viroid. Of these, Grapevine leafroll-associated virus 7 (GLRaV-7), an unassigned closterovirus, was by far the most prominently represented sequence in the analysis. Graft-inoculation of the infection to another grape variety confirmed the lack of...
Resource Type:: Article
Full Text:: and B. Plant Dis. 95, 657–665. ing, K.-S., Zhu, H.-Y., Gonsalves, D., 2004. Complete nucleotide

Improbability mapping: a metric for satellite-detection of submarine volcanic eruptions

Creator:: O'Malley, Robert T., Behrenfeld, Michael J., Westberry, Toby K., Milligan, Allen J., Reese, Douglas C., and Halsey, Kimberly H.
Abstract:: Submarine volcanic eruptions can result in both real and apparent changes in marine algal communities, e.g., increases in phytoplankton biomass and/or growth rates that can cover thousands of square kilometers. Satellite ocean color monitoring detects these changes as increases in chlorophyll and particulate backscattering. Detailed, high resolution analysis is needed...
Resource Type:: Article

Rendimiento de Papa en Funcion de Epidemia por Tizon Tardio (Phytophthora infestans Mont. de Bary)

Creator:: Romero Montes, Gaspar, Lozoya Saldana, Hector, Mora Aguilera, Gustavo, Fernandez Pavia, Sylvia, and Gruenwald, Niklaus J.
Abstract:: SEE ARTICLE FOR ABSTRACT IN SPANISH. English Abstract: In order to study the quantitative relationship between tuber yield of two potato (Solanum tuberosum L.) cultivars (‘Alpha’, susceptible, and ‘Zafiro’, moderately resistant to late blight), and severity of the pathogen in Toluca, México, managed by weekly foliar sprays of 0.575 kg...
Resource Type:: Article
Full Text:: Chapingo. 56230, Chapingo, Méx. Tel. 01 (595) 952-1500 Ext. 6135. 3 Instituto de Fitosanidad, Colegio de

Real-time RT-PCR for detection of Raspberry bushy dwarf virus, Raspberry leaf mottle virus and characterizing synergistic interactions in mixed infections

Creator:: Quito-Avila, Diego F. and Martin, Robert R.
Abstract:: Two TaqMan-based real-time One-Step RT-PCR assays were developed for the rapid and efficient detection of Raspberry bushy dwarf virus (RBDV) and Raspberry leaf mottle virus (RLMV), two of the most common raspberry viruses in North America and Europe. The primers and probes were designed from conserved fragments of the polymerase...
Resource Type:: Article
Full Text:: TTGCGTATTCGTCCATAGGTC arameters: 15 min at 45 ◦C, 10 min at 95 ◦C, and 40 cycles of 15 s t 95 ◦C and 50 s at 60 ◦C

Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

Creator:: Manning, Viola A., Pandelova, Iovanna, Dhillon, Braham, Wilhelm, Larry J., Goodwin, Stephen B., Berlin, Aaron M., Figueroa, Melania, Freitag, Michael, Hane, James K., Henrissat, Bernard, Holman, Wade H., Kodira, Chinnappa D., Martin, Joel, Oliver, Richard P., Robbertse, Barbara, Schackwitz, Wendy, Schwartz, David C., Spatafora, Joseph W., Turgeon, B. Gillian, Yandava, Chandri, Young, Sarah, Zhou, Shiguo, Zeng, Qiandong, Grigoriev, Igor V., Ma, Li-Jun, and Ciuffetti, Lynda M.
Abstract:: Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins ( HST), which are recognized by their host in a genotype-specific...
Resource Type:: Article
Full Text:: each primer, 0.25 U of GoTaq DNA polymerase and 20 ng of DNA. PCR conditions were 95� for 5 min, 30

Complementation of tobacco etch potyvirus mutants by active RNA polymerase expressed in transgenic cells

Creator:: Li, Xiao Hua and Carrington, James C.
Abstract:: A genetic complementation system was developed in which tobacco etch virus (TEV) polymerase (NIb)- expressing transgenic plants or protoplasts were inoculated with NIb-defective TEV mutants. A β-glucuronidase (GUS) reporter gene integrated into the genomes of parental and four mutant viruses was used to assay RNA amplification. Two mutants (termed VNN...
Resource Type:: Article
Full Text:: 4._ 0 *W ct CQ 140 120 100 80 60 40 20 015 ,1 Biochemistry: Li and Carrington 1 5 460

Phylogeny and Biogeography of Primula sect. Parryi (Primulaceae)

Creator:: Kelso, Sylvia, Beardsley, Paul M., and Weitemier, Kevin
Abstract:: Primula sect. Parryi comprises five species endemic to western North America: P. parryi, P. angustifolia, P. rusbyi, P. capillaris, and P. cusickiana with four varieties. This section, derived from a clade with representatives in Asia and Europe, exemplifies a phytogeographic pattern in which a widespread species is accompanied by multiple...
Resource Type:: Article
Full Text:: ; 88%), New Mexico (P4; 95%), and Arizona (P6, P7; 97%). Colorado popu- lations (P1–P3, P5) do not

ScholarsArchive@OSU

Gramene: a resource for comparative grass genomics

Inoculum Reduction Measures to Manage Armillaria Root Disease in a Severely Infected Stand of Ponderosa Pine in South-Central Washington: 35-Year Results

Insights into phylogeny, sex function and age of Fragaria based on whole chloroplast genome sequencing

Genomic and biological analysis of Grapevine leafroll-associated virus 7 reveals a possible new genus within the family Closteroviridae

Improbability mapping: a metric for satellite-detection of submarine volcanic eruptions

Rendimiento de Papa en Funcion de Epidemia por Tizon Tardio (Phytophthora infestans Mont. de Bary)

Real-time RT-PCR for detection of Raspberry bushy dwarf virus, Raspberry leaf mottle virus and characterizing synergistic interactions in mixed infections

Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

Complementation of tobacco etch potyvirus mutants by active RNA polymerase expressed in transgenic cells

Phylogeny and Biogeography of Primula sect. Parryi (Primulaceae)

Limit your search

Academic Affiliation

Creator

Date

Decade

File Format

Language

License

Location

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search