Index Catalog // ScholarsArchive@OSU

Evaluation of physical and thermal methods to support nonlinear cost optimization models of surimi seafood

Creator:: Hsü, Cheng-kuang
Abstract:: Optimization programming techniques were applied to develop the least cost formulations for Pacific whiting surimi-based seafood (PWSBS). To develop the quality constraint functions, texture and color of whiting surimi gels were determined by torsion test and colorimeter, respectively. Whiting surimi gels were produced by heating at 90°C for 15 min....
Resource Type:: Dissertation
Full Text:: Abstract approved: Edward R. Kolbe Optimization programming techniques were applied to develop the

Solving algebra word problems : solution strategies Thai students used and potential connections with teachers' instructional strategies

Creator:: Swangrojn, Porntip
Abstract:: The main purpose of this study was to investigate and describe strategies that Thai ninth grade students use to solve algebra word problems. The second purpose of this study was to investigate teachers' instruction during word problem solving lessons. Three mathematics teachers and one of each of their classes participated...
Resource Type:: Dissertation
Full Text:: . ------------+- ----~~~---c.-,......._~ r f \;;;;;;.,iic Dianne K. Erici'son The main purpose of this study was to

The relationship of a problem-based calculus course and students' views of mathematical thinking

Creator:: Liu, Po-Hung
Abstract:: It has been held that heuristic training alone is not enough for developing one's mathematical thinking. One missing component is a mathematical point of view. Many educational researchers have proposed problem-based curricula to improve students' views of mathematical thinking. The present study reports findings regarding effects of a problem-based calculus...
Resource Type:: Dissertation
Full Text:: extended to my minor professor, Dr. Barbara Edwards, for her moral support and professional supervision. I

Factors controlling halogenated and nonhalogenated alkene growth substrate range of vinyl chloride-utilizing bacteria

Creator:: Taylor, Anne Elizabeth
Abstract:: This thesis explores the factors limiting the alkene substrate range of the vinyl chloride (VC)-utilizing bacteria, and describes a method for measuring VC transformation in situ. Vinyl fluoride (VF) was evaluated as a surrogate for monitoring aerobic VC-transformation utilizing three isolates, Mycobacterium EE13a, Mycobacterium JS60 and Nocardioides JS614. JS614 grew...
Resource Type:: Dissertation
Full Text:: preparation for Chapter 2. Dr. Daniel Arp contributed scientific discussion and ideas for experimental

Genome-enabled discovery and characterization of type III effector-encoding genes of plant symbiotic bacteria

Creator:: Kimbrel, Jeffrey A.
Abstract:: Symbiosis is the close and protracted interaction between organisms. The molecular interactions that occur during symbiosis are complex with multiple barriers that must be overcome. Many Gram-negative, host-associated bacteria use a type III secretion system to mediate associations with their eukaryotic hosts. This secretion system is a specialized apparatus for...
Resource Type:: Dissertation

Community composition and activities of denitrifying bacteria in soils

Creator:: Rich, Jeremy J.
Abstract:: Few studies have directly compared denitrifying community composition and activities in soils by coupling molecular-genetic techniques and traditional measures of denitnfication. I investigated communities of denitrifying bacteria from adjacent meadow and forest soils in the Cascade Mountains, Oregon. A key gene in the denitrification pathway, N₂O reductase (nosZ), served as...
Resource Type:: Dissertation
Full Text:: the reverse primer (nosZ-R-1880; I=inosine, Y=T+C, K=T+G, R=A+G). Numbers in parentheses indicate

Interactions between microbial dynamics, water flow, and solute transport in unsaturated porous media

Creator:: Yarwood, Rockie R.
Abstract:: Bioremediation in the vadose zone is unpredictable because of poor understanding of factors influencing microbial growth in this environment. A lab-scale experimental system was developed to examine, noninvasively, interactions between microbial growth, water flow, and solute transport in unsaturated porous media. Measurements of microbial colonization, and its impact on hydrology,...
Resource Type:: Dissertation
Full Text:: members, Dr. Daniel Arp and Dr. Jennifer Field, and to Dr. Linda Blythe. Special thanks to Dr. Larry

Aerobic biotransformation of chlorinated aliphatic hydrocarbons by a benzyl alcohol grown mixed culture : cometabolism, mechanisms, kinetics and modeling

Creator:: Tejasen, Sarun
Abstract:: The aerobic transformation of TCE and cis-DCE by a tetrabutoxysilane-grown microorganism (Vancheeswaran et al., 1999) led to the investigation of novel substrates, including benzyl alcohol, for promoting cometabolism. The culture grew on carboxylic compounds and alcohols, but did not grow on formate, methanol, methane, propane, butane, ethylene, benzene, toluene, or...
Resource Type:: Dissertation
Full Text:: K values matched well with observed data from batch tests. Benzyl alcohol was shown to be an

Identification of quantitative trait loci underlying kernel extra-softness and related traits by linkage and association mapping in wheat (Triticum aestivum L.)

Creator:: Wang, Guomei
Abstract:: Kernel hardness (KHA) is a major factor determining break flour yield (BFY) and end-use quality of common wheat (Triticum aestivum L.). Within the soft wheat class, genotypes with consistently softer grains than common soft wheat are considered to be 'extra-soft'. In addition, 'extra-soft' wheats have greater BFY than common soft...
Resource Type:: Dissertation
Full Text:: research data of this dissertation, and Dr. Daniel J. Arp for serving as my graduate council

The Oregon Coastal Subprovince, a new biogeographic subprovince for primary freshwater fishes in Oregon

Creator:: Kettratad, Jes
Abstract:: The Pacific Northwest has a relatively low diversity of primary freshwater fishes with most of the endemism and diversity in the Columbia River and Klamath River. However, the Oregon Coastal Subprovince defined as the coastal rivers from Miami River in the north to Sixes River in the south, has a...
Resource Type:: Dissertation
Full Text:: ′-AACTGCAGTCATCTCCGGTTTAC-3′; modified from Irwin et al., 1991), L15424 (5′- ATTTCTTTCCACCCATACTTTTC -3′; Edwards et al

ScholarsArchive@OSU

Evaluation of physical and thermal methods to support nonlinear cost optimization models of surimi seafood

Solving algebra word problems : solution strategies Thai students used and potential connections with teachers' instructional strategies

The relationship of a problem-based calculus course and students' views of mathematical thinking

Factors controlling halogenated and nonhalogenated alkene growth substrate range of vinyl chloride-utilizing bacteria

Genome-enabled discovery and characterization of type III effector-encoding genes of plant symbiotic bacteria

Community composition and activities of denitrifying bacteria in soils

Interactions between microbial dynamics, water flow, and solute transport in unsaturated porous media

Aerobic biotransformation of chlorinated aliphatic hydrocarbons by a benzyl alcohol grown mixed culture : cometabolism, mechanisms, kinetics and modeling

Identification of quantitative trait loci underlying kernel extra-softness and related traits by linkage and association mapping in wheat (Triticum aestivum L.)

The Oregon Coastal Subprovince, a new biogeographic subprovince for primary freshwater fishes in Oregon

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search