Search Constraints

Start Over
Filtering by: Alternative title ssim Information report 73-3 Remove constraint Alternative title ssim: Information report 73-3 Creator Vondras, Amanda M. Remove constraint Creator: Vondras, Amanda M. Degree Name Doctor of Philosophy (Ph.D.) Remove constraint Degree Name: Doctor of Philosophy (Ph.D.)

Search Results

  • Developmental differences in Vitis vinifera berries and the impact of GLRaV3 on the transcriptome during ripening

    Creator:
    Vondras, Amanda M.
    Abstract:
    In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
    Resource Type:
    Dissertation
    Full Text:
    véraison. Grape Leafroll-associated Virus 3 (GLRaV3) is the most consequential virus that affects

  • Supplemental File. miRNA Hairpins.pdf

    Creator:
    Vondras, Amanda M.
    Abstract:
    In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
    Resource Type:
    Dissertation
    Full Text:
    Hairpin #1 Hairpin #2 Hairpin #3 Hairpin #4 Hairpin

  • Supplemental File. Next-generation sequencing.xlsx

    Creator:
    Vondras, Amanda M.
    Abstract:
    In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
    Resource Type:
    Dissertation
    Full Text:
    GTGGCC 9_6_12_GS_Virus1 773 92.74 8,250,562 4.12 100 0 92.83 36.12 3 lane3-index-TGACCA-9_17_12_RS_Con1

  • Supplemental File. miRNA Hairpin Key and Annotation.xlsx

    Creator:
    Vondras, Amanda M.
    Abstract:
    In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
    Resource Type:
    Dissertation

  • Supplemental File. Differentially abundant sRNA and targets.xlsx

    Creator:
    Vondras, Amanda M.
    Abstract:
    In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
    Resource Type:
    Dissertation
    Full Text:
    3 Multiplicity Target annotation Target functional category sRNA-8542 ACCCCGTATGCTGAGAGTGTG 1.5 -1

  • Supplemental File. miRNA targets.txt

    Creator:
    Vondras, Amanda M.
    Abstract:
    In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
    Resource Type:
    Dissertation

  • Supplemental File. DCeN scores.xlsx

    Creator:
    Vondras, Amanda M.
    Abstract:
    In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
    Resource Type:
    Dissertation

  • Developmental differences in Vitis vinifera berries and the impact of GLRaV3 on the transcriptome during ripening

    Creator:
    Vondras, Amanda M.
    Abstract:
    In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
    Resource Type:
    Dissertation