Index Catalog // ScholarsArchive@OSU

Alternatives to the DNA precursor-synthesizing enzyme complex hypothesis

Creator:: Weitz, Stephen L.
Abstract:: Investigators have been studying an aggregate containing enzymes of deoxyribonucleoside triphosphate biosynthesis in T4-phage infected bacteria. They suggest that it behaves as an organized complex, efficiently channeling DNA precursors to the replication apparatus. Previous work has suggested that about 10 enzyme activities remain associated through several fractionation steps. This multi-enzyme...
Resource Type:: Dissertation
Full Text:: it and the cellular dCTP deaminase display moonier:se EC DNA polymoroso EC \ dCMP

Host kinases involved in DNA precursor biosynthesis during bacteriophage T4 infection

Creator:: Bernard, Mark Aguirre
Abstract:: Although the Escherichia coli host has almost all of the enzymes necessary to synthesize nucleotides needed for bacteriophage T4 DNA replication, phage genes expressed early in infection encode enzymes for de novo DNA precursor biosynthesis and salvage from degraded host DNA. Eight early enzymes and two host enzymes comprise the...
Resource Type:: Dissertation

The microtubule system and the canalicular mdr2 P-glycoprotein play a role in the intracellular transport and biliary secretion of α-Tocopherol and phosphatidylcholine in rats and mice

Creator:: Mustacich, Debbie J.
Resource Type:: Dissertation
Full Text:: lipoproteins. Am. J Clin. Nutr. 49, 517-526. Traber, M.G., Kayden, H.J., Green, J.B., and Green, M.H. (1986

Intercalation on hydrocarbons in polynucleotides

Creator:: Craig, Albert Morrie
Abstract:: The binding of eleven polycyclic, aromatic hydrocarbons to the acid form of poly A has been investigated. The hydrocarbons were chosen to test a size criterion. Model building showed that some hydrocarbons could intercalate in the helix and be well protected from contact with the aqueous solvent. Experimentally it was...
Resource Type:: Dissertation
Full Text:: BIOCHEMISTRY/BIOPHYSICS presented on V_)ec;11) )170 (Department) (Date) Title: INTERCALATION OF HYDROCARBONS

Characterization of the infection cycle of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus in Lymantria dispar cells

Creator:: Bradford, Mary Beth
Abstract:: The Baculoviridae is a family of DNA viruses which are obligate pathogens for a variety of insects. Baculovirus strains came to the attention of researchers because they provided a nonchemical alternative for the biological control of insect pests of agriculture and forestry (Ignoffo, 1968); however, recently they have been studied...
Resource Type:: Masters Thesis

Cloning and characterization of a polyketide-like gene cluster from Streptomyces murayamaensis

Creator:: Fuller, Geoffrey A.
Resource Type:: Dissertation
Full Text:: CGCGAGATCCGGCGGCTCGACCGCGCC'GCCCAGTTCOCCGTGGTGAGCGCCCGTGAGTGC 241 + 300 R A Q F A V V S AE I R LD18 A R EC

Intramolecular and intermolecular strand hybridization during adenovirus DNA replication

Creator:: Xu, Fu-yun
Abstract:: Adenovirus initiates strand-displacement DNA replication from origins located in identical inverted terminal repetitions (ITRs). Panhandle structures, formed by base-pairing between ITRs on the displaced strands, have been proposed as replication intermediates for complementary strand synthesis. Plasmid molecules containing a single adenovirus terminal sequence and specially arranged inverted repeat sequences were...
Resource Type:: Dissertation

Underlying Mechanisms of the Anti-inflammatory and Antioxidant Effects of Quercetin in Human Aortic Endothelial Cells : Implications for Vascular Inflammation and Atherosclerosis

Creator:: Li, Chuan
Abstract:: Atherosclerosis is the underlying cause of ischemic heart disease and stroke and is the leading cause of death worldwide, especially in developed countries. As an inflammatory disease of arteries in a hyperlipidemic milieu, expression of adhesion molecules, such as endothelial-leukocyte adhesion molecule-1 (E-selectin) and intercellular adhesion molecule-1 (ICAM-1), on endothelial...
Resource Type:: Dissertation

Mercury and cadmium binding proteins in marine mammal tissues

Creator:: von der Trenck, Karl Theodor
Abstract:: The subcellular fractions of liver and kidney from three bearded seals (Erignathus barbatus nauticus) and three walrus (Odobenus rosmarus divergens) were analyzed for cadmium and mercury content, and the results were compared with the results of subcellular fractionation of the same organs from two sea lions (Zalophus callfornianus californianus) obtained...
Resource Type:: Masters Thesis
Full Text:: - dithioerythritol EC - electron capture g gram(s) GLC - gas-liquid chromatography GSH glutathione G6PD

In vivo Reactions of Tetrazines Incorporated through Genetic Code Expansion

Creator:: Blizzard, Robert J.
Abstract:: The inverse electron demand Diels Alder reaction between tetrazines and strained alkenes is an exceptionally useful tool in functionalizing to biomolecules since it is orthogonal to the chemistry of most living systems and have exceptionally high rate constants. In particular reactions between strained trans-cyclooctenes (sTCO) and tetrazines can achieve second...
Resource Type:: Dissertation

ScholarsArchive@OSU

Alternatives to the DNA precursor-synthesizing enzyme complex hypothesis

Host kinases involved in DNA precursor biosynthesis during bacteriophage T4 infection

The microtubule system and the canalicular mdr2 P-glycoprotein play a role in the intracellular transport and biliary secretion of α-Tocopherol and phosphatidylcholine in rats and mice

Intercalation on hydrocarbons in polynucleotides

Characterization of the infection cycle of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus in Lymantria dispar cells

Cloning and characterization of a polyketide-like gene cluster from Streptomyces murayamaensis

Intramolecular and intermolecular strand hybridization during adenovirus DNA replication

Underlying Mechanisms of the Anti-inflammatory and Antioxidant Effects of Quercetin in Human Aortic Endothelial Cells : Implications for Vascular Inflammation and Atherosclerosis

Mercury and cadmium binding proteins in marine mammal tissues

In vivo Reactions of Tetrazines Incorporated through Genetic Code Expansion

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Date

Decade

Degree Field

Degree Level

Degree Name

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search