Index Catalog // ScholarsArchive@OSU

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Creator:: Bernier, Jeremiah C.
Abstract:: Chinook salmon (Oncorhynchus tshawytscha) display the greatest variability of return times to freshwater of all Pacific salmon. Differential return times to freshwater have segregated populations of Chinook into two broad types or runs, fall and spring, named for the time of year in which they migrate to freshwater. Migration time...
Resource Type:: Masters Thesis
Full Text:: cytochrome c oxidase subunit III 18681 CATGACTTAGCAAGAAATGGA 0 0 18 9.09 n/a uniquely present QM (ribosomal

Mortality threshold for juvenile Chinook salmon (Oncorhynchus tshawytscha) in an epidemiological model of Ceratomyxa shasta

Creator:: Ray, R. Adam
Abstract:: The myxozoan parasite, Ceratomyxa shasta, is the most significant pathogen of juvenile Chinook salmon (Oncorhynchus tshawytscha) in the Klamath River, CA, USA. This parasite requires two hosts - a freshwater polychaete (Manayunkia speciosa) and a salmonid - to complete its life cycle. The complex life cycle and large geographic area...
Resource Type:: Masters Thesis
Full Text:: stage, which in turn infects a salmonid host. The distribution of C. shasta is limited to certain

Stress induced differential gene expression in the brain of juvenile steelhead trout, (Oncorhynchus Mykiss)

Creator:: Schwindt, Adam R.
Abstract:: Gene expression profiles of tissues and cell-lines can be powerful tools for documenting the genetic response to a particular treatment, such as stressors. However, there is a paucity of information on the genetic stress response in the brain. Therefore, we attempted to profile gene expression in the brain of juvenile...
Resource Type:: Masters Thesis
Full Text:: -Ann C. Leong, Wilfrido Contreras-Sánchez, and Carl B. Schreck 2 ABSTRACT We utilized suppression

Growth, residence, and movement of juvenile Chinook salmon within restored and reference estuarine marsh channels in Salmon River, Oregon

Creator:: Hering, David K.
Abstract:: Tidal wetland channels provide rearing habitat for juvenile Chinook salmon as they emigrate from freshwater habitat and prepare to enter the ocean. Widespread diking and drainage of estuarine marshes for agricultural and urban development may have contributed to a decline in salmon abundance in the Pacific Northwest, prompting efforts to...
Resource Type:: Masters Thesis
Full Text:: estuary depicting tidal wetland areas restored by dike removal in (a) 1978, (b) 1987, and (c) 1996

Effects of steelhead trout (Oncorhynchus mykiss) on chinook salmon (O. tshawytscha) behavior and physiology

Creator:: Kelsey, Denise A.
Abstract:: Three experiments were designed to determine if and how steelhead trout, Oncorhynchus mykiss, may affect chinook salmon, O. tshawytscha, when they are confined together as in a raceway or on a barge. We observed groups of chinook and steelhead together and groups of only chinook in a behavioral experiment to...
Resource Type:: Masters Thesis
Full Text:: treatments (c) 9 3. Mean number of aggressive attacks (+SE) in the Mix treatment by chinook (a) and by

Habitat selection of hatchery and wild juvenile salmonids in Eagle Creek Basin, Oregon

Creator:: Brignon, William R.
Abstract:: To best manage Eagle Creek National Fish Hatchery and minimize any negative impacts that the current hatchery program may be having on Endangered Species Act-listed salmonids in the Eagle Creek Basin, I determined if wild fish are being displaced from preferred habitats by hatchery salmonids Oncorhynchus spp. This thesis had...
Resource Type:: Masters Thesis
Full Text:: . CONTRIBUTION OF AUTHORS Carl B. Schreck, David L. G. Noakes, Howard A. Schaller and Douglas E. Olson assisted

Linking Moral Obligations, Assumption-based Research, and Structured Decision Making to Inform Bull Trout Recovery

Creator:: Brignon, William R.
Abstract:: More than 1500 species of plants and animals in the United States are listed as threatened or endangered under the Endangered Species Act (ESA). The U.S. Departments of Interior and Commerce are required, under Section 4(f)(1) of the ESA, to develop recovery plans for ESA-listed species under the respective agency...
Resource Type:: Dissertation
Full Text:: AUTHORS Drs. Carl B. Schreck and Howard A. Schaller served as co-principal investigators, provided

The physiology ecology and run diversity of adult Pacific lamprey, Entosphenus tridentatus, during the freshwater spawning migration

Creator:: Clemens, Benjamin J.
Abstract:: Pacific lamprey, Entosphenus tridentatus, have shown recent and rapid declines in abundance. These anadromous fish return to streams where they mature, spawn and die. It has been inferred that Pacific lamprey enter freshwater and reside for ~ 1 year before spawning. This long exposure to the freshwater environment may affect...
Resource Type:: Dissertation
Full Text:: administration. Appendix A: Stacia Sower and Carl Schreck assisted with interpretation of gonad stages and

Capture-related stressors impair sablefish, Anoplopoma fimbria, immune system function

Creator:: Lupes, Sarah C.
Abstract:: Sablefish, Anoplopoma fimbria, is a valuable North Pacific Ocean species caught in several commercial fisheries and is often discarded due to size or catch limits. Managers must account for the mortality of discarded fish to assess fish populations and harvest impacts, yet discard mortality rates of specific fisheries are generally...
Resource Type:: Masters Thesis
Full Text:: Sarah C. Lupes A THESIS submitted to Oregon State University in partial fulfillment of the

The effect of chronic exposure of chinook salmon to benzo(a)pyrene and cortisol of CYP1A1 induction and susceptibility to a microsporidian parasite, Loma salmonae

Creator:: Marie, Amarisa
Abstract:: Wild populations of fish are faced with a multitude of stressors, which may include human interaction, toxins, and disease. Benzo(a)pyrene (BaP), a known carcinogen and immunotoxin, has been reported in the stomach contents of juvenile chinook salmon, Oncorhynchus tshawytscha, in urban waterways. We investigated the impact of chronic dietary exposure...
Resource Type:: Masters Thesis
Full Text:: . Feist, Jo-ann C. Leong, Carl B. Schreck. 2 ABSTRACT Wild populations of fish are faced with a

ScholarsArchive@OSU

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Mortality threshold for juvenile Chinook salmon (Oncorhynchus tshawytscha) in an epidemiological model of Ceratomyxa shasta

Stress induced differential gene expression in the brain of juvenile steelhead trout, (Oncorhynchus Mykiss)

Growth, residence, and movement of juvenile Chinook salmon within restored and reference estuarine marsh channels in Salmon River, Oregon

Effects of steelhead trout (Oncorhynchus mykiss) on chinook salmon (O. tshawytscha) behavior and physiology

Habitat selection of hatchery and wild juvenile salmonids in Eagle Creek Basin, Oregon

Linking Moral Obligations, Assumption-based Research, and Structured Decision Making to Inform Bull Trout Recovery

The physiology ecology and run diversity of adult Pacific lamprey, Entosphenus tridentatus, during the freshwater spawning migration

Capture-related stressors impair sablefish, Anoplopoma fimbria, immune system function

The effect of chronic exposure of chinook salmon to benzo(a)pyrene and cortisol of CYP1A1 induction and susceptibility to a microsporidian parasite, Loma salmonae

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Location

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search