Index Catalog // ScholarsArchive@OSU

Creator:: Truong, Thi B.
Abstract:: Studies of Hawaiian volcanoes contribute valuable insights about Earth processes and mantle evolution, and are fundamental for understanding the construction of the largest volcanoes on terrestrial planets. The pre-shield stage exists in every Hawaiian volcano, but is usually blanketed by high volume tholeiitic lava flows during the main shield stage....
Resource Type:: Dissertation
Full Text:: stage, but shows a transition to early shield-type tholeiitic eruptions. In this dissertation, the

Creator:: Maruyama, Shumpei
Abstract:: Coral reefs form vast ecosystems in tropical oceans that are hotspots for biodiversity and are economically valuable. The ecological success of coral reefs is made possible by the symbiotic relationship between corals and dinoflagellate algae from the family Symbiodiniaceae. In this symbiosis, the algae are found within host gastrodermal cells...
Resource Type:: Dissertation
Full Text:: characterization of a P-type H+-ATPase gene. Proc. R. Soc. Lond. B Biol. Sci. 277:87–95. Biquand, E., Okubo, N

Creator:: Feng, Guangxi
Abstract:: Cell division, arguably the most important event during the life cycle of the eukaryotic cell, is achieved through a complicated yet beautiful machinery. The mitotic spindle — a microtubule-based bipolar structure—is the cellular machinery responsible for the correct segregation of the genetic material, chromosomes. The protein-based nanomachines termed molecular motors...
Resource Type:: Dissertation
Full Text:: most important event during the life cycle of the eukaryotic cell, is achieved through a complicated

Creator:: Vondras, Amanda M.
Abstract:: In the study of any developmental process, whether in plants, animals, or other models, it is prudent to consider the developmental position of the subjects being measured. This is generally not taken into consideration in grapevine studies despite a growing body of literature documenting that fruits within clusters develop and...
Resource Type:: Dissertation
Full Text:: ACCCCGUAUGCUGAGAGUGUG CACGUUCUCAGCAUACGGGGU Cleavage VIT_213s0019g00380 gene=VIT_213s0019g00380 CDS=1-6897 1 R protein

Creator:: Anderson, Nicole P.
Abstract:: One important cool-season perennial grass seed crop grown in Oregon is fine fescue (Festuca rubra L.). Open-field burning has been used for many decades to manage pests, cycle nutrients, and stabilize yield, in fine fescue seed fields, especially as stands age. Legislative restrictions currently limit open-field burning to 6,070 hectares...
Resource Type:: Dissertation
Full Text:: defoliation treatments were made with a flail mower and consisted of (i) no defoliation, (ii) early

ScholarsArchive@OSU