Index Catalog // ScholarsArchive@OSU

Studies on the evolution and expression of the Type II ferripyoverdine receptor gene fpvAIIb in Pseudomonas aeruginosa

Creator:: Glover, Rochelle
Abstract:: When iron levels are low, the opportunistic pathogen Pseudomonas aeruginosa secretes the high-affinity iron-binding siderophore pyoverdine. The cognate ferripyoverdine receptor, FpvA, has gained attention as the most divergent gene in the organism’s genome, showing substantial evidence of positive selection. S-type pyocins, bacteriocins with specificity to Pseudomonads, enter cells through FpvA...
Resource Type:: Honors College Thesis
Full Text:: 0.50% (w/v) casamino acids (CAA), 25μM 3-morpholinopropane-1-sulfonic acid (MOPS), 0.25 g L-1 MgSO4

Characterization of Quorum-Sensing Diversity in Environmental Pseudomonas aeruginosa Populations

Creator:: Grellmann, Elise Kaylene
Abstract:: While the quorum-sensing (QS) diversity of the opportunistic pathogen Pseudomonas aeruginosa has been well established in cystic fibrosis (CF) lung infections and in vitro experiments, little is known about its QS-diversity in natural environments. One significant QS-deficient behavior is social cheating. Social cheaters contain mutations that prevent them from producing...
Resource Type:: Honors College Thesis
Full Text:: aeruginosa Populations. Abstract approved: Martin Schuster While the quorum-sensing (QS

Study on the Evolution and Expression of the Pyoverdine Receptor FpvA inPseudomonas aeruginosa

Creator:: Singh, Amandip
Abstract:: Pseudomonas aeruginosa is a ubiquitous gram-negative bacterium that is capable of causing infections in people who are immune compromised. The bacterium can live in a variety of environments due to the variety of virulence factors it can produce. It is well adapted to living in iron-stringent conditions because it can...
Resource Type:: Honors College Thesis
Full Text:: | Wildtype: TTCATGCTGGCGCCGAGCTTTACCTGGAACCCCAACGAGCAGACCAGCCTGA F M L A P S F T W N P

Playing by the Rules: A Formal Specification of BoGL’s Loops and Type System

Creator:: Grejuc, Alex
Abstract:: BoGL is a programming language created for the purpose of computer science education that is specific to the domain of board games. Although there is a language grammar and an existing implementation that is currently used by students, a complete and formal language standard does not yet exist. In the...
Resource Type:: Honors College Thesis
Full Text:: Abstract approved: Martin Erwig BoGL is a programming language created for the purpose of computer

A Genome-Wide, Phenotypic Screen for Genes Regulating Quorum Sensing in Pseudomonas aeruginosa

Creator:: Gobble, Timothy Robert
Abstract:: The opportunistic pathogen Pseudomonas aeruginosa possesses two LuxR-LuxI type quorum-sensing systems that use diffusible acyl-homoserine lactone molecules to autoinduce and coordinate expression of multiple virulence factors. We conducted a highthroughput screen for mutants deficient in skim-milk proteolysis—a quorum-sensing dependent phenotype—using a nonredundant transposon-insertion library representing most nonessential genes in P....
Resource Type:: Honors College Thesis
Full Text:: Martin Schuster The opportunistic pathogen Pseudomonas aeruginosa possesses two LuxR-LuxI

Strain construction to test the significance of antiactivation in Pseudomonas quorum sensing

Creator:: Goff, Shannon Elise
Abstract:: The quorum sensing regulatory pathway has been extensively studied for its impact on the virulence of Pseudomonas aeruginosa, an opportunistic pathogen that causes acute and chronic infections in immunocompromised individuals such as those suffering from the genetic disorder cystic fibrosis. Part of the quorum sensing pathway that has not been...
Resource Type:: Honors College Thesis
Full Text:: . Abstract approved: Martin Schuster The quorum sensing regulatory pathway has been extensively studied

Insight into the regulation of quorum sensing antiactivator genes qteE and qslA in Pseudomonas aeruginosa

Creator:: Lawless, Finn
Abstract:: Ubiquitous pathogen Pseudomonas aeruginosa coordinates population-wide activation of virulence genes through quorum sensing (QS), where individuals transition from solo to social behaviors to benefit the population. QS is complex and mechanisms vary from species to species, but the concept is common to the bacterial world and has implications in various...
Resource Type:: Honors College Thesis
Full Text:: aeruginosa. Abstract approved:_____________________________________________________ Martin

Mining Public Microbiome Datasets to Identify Specific Microbial Taxa Associated with Anxiety-Related Disorders

Creator:: Martin, Austin N.
Abstract:: Over the last ten years, clinical, pre-clinical and animal studies have shown associations between the microbiota and neurological functions. Recent work by the scientific community on the gut-microbiome-brain axis have revealed that gut dysbiosis and specific microbial taxa are associated with a myriad of neurological conditions, such as autism spectrum...
Resource Type:: Honors College Thesis
Full Text:: Associated with Anxiety-Related Disorders by Austin Martin A THESIS

High Resolution Spectroscopy of Bicyclo[1.1.1]pentane

Creator:: Martin, Matthew A.
Abstract:: The strained carbon ring, bicyclo[1.1.1]pentane, was synthesized by a reaction between 1-(phenylsulfanyl)bicyclo[1.1.1]pentane, prepared from propellane, and Raney nickel. Infrared spectra were recorded at a resolution of 0.0015 cm-1, a resolution significantly better than previous measurements, 0.06 cm-1. A single fundamental band was analyzed to determine the ground state and excited...
Resource Type:: Honors College Thesis
Full Text:: AN ABSTRACT OF THE THESIS OF Matthew A. Martin for the degree of Honors Baccalaureate of Science in

The Remember Center - Care Center for Trafficked Children in Ghana, Africa

Creator:: Briscoe, Halli L.
Abstract:: The Remember Center (TRC) is a long term care center for previously trafficked children. In Ghana, there is a huge child trafficking problem because of the impoverished state the country is in and the lack of involvement from the government. With the fishing industry depleting because Lake Volta is running...
Resource Type:: Honors College Thesis
Full Text:: _____________________________________________________________________ Larry Martin, Committee Member, representing College of Business

ScholarsArchive@OSU

Studies on the evolution and expression of the Type II ferripyoverdine receptor gene fpvAIIb in Pseudomonas aeruginosa

Characterization of Quorum-Sensing Diversity in Environmental Pseudomonas aeruginosa Populations

Study on the Evolution and Expression of the Pyoverdine Receptor FpvA inPseudomonas aeruginosa

Playing by the Rules: A Formal Specification of BoGL’s Loops and Type System

A Genome-Wide, Phenotypic Screen for Genes Regulating Quorum Sensing in Pseudomonas aeruginosa

Strain construction to test the significance of antiactivation in Pseudomonas quorum sensing

Insight into the regulation of quorum sensing antiactivator genes qteE and qslA in Pseudomonas aeruginosa

Mining Public Microbiome Datasets to Identify Specific Microbial Taxa Associated with Anxiety-Related Disorders

High Resolution Spectroscopy of Bicyclo[1.1.1]pentane

The Remember Center - Care Center for Trafficked Children in Ghana, Africa

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Conference Name

Conference Section/Track

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search