Index Catalog // ScholarsArchive@OSU

Start Over

Filtering by: Creator Duncan, Sara R. File Format application/msword Peer Reviewed No

The possibility of international agreements concerning genetically modified organisms in the European Union

Creator:

Fairbrother, Jennifer R.

Abstract:

As genetically modified products come under greater production, tensions surrounding the potential benefits and harms of the technology have appeared in divergent policy between the European Union (EU) and certain member states. The purpose of this thesis is to consider whether some type of international law, also called an environmental...

Resource Type:

Honors College Thesis

Full Text:

International Agreements Concerning Genetically Modified Organisms in the European Union by Jennifer R
Studies on a transgenic approach to decrease gliadin content in wheat

Creator:

Bell, Shannon M.

Abstract:

Celiac disease, an autoimmune response triggered by the consumption of seed storage proteins of cereals, affects an estimated 1% of the human population. In the case of wheat (Triticum aestivum L.), one of the world’s most consumed cereals, alcohol-soluble proteins, the gliadins, have been identified as the allergy-eliciting agents. Previous...

Resource Type:

Undergraduate Thesis

Full Text:

using a variety of PCR primers (Fig. 10). Primers RI_ANTI F (5’ CAAATTCTAATCCCCAATCCAA 3’) and RI_ANTI R