Search Constraints

Start Over
Filtering by: Creator Triska, F. J. Remove constraint Creator: Triska, F. J. File Format application/msword Remove constraint File Format: application/msword

Search Results

  • Integration of submersible transect data andhigh-resolution sonar imagery for a habitat-based groundfish assessment of Heceta Bank, Oregon

    Creator:
    Nasby, Nicole M.
    Abstract:
    Dramatic declines in several groundfish populations have occurred along the U.S. West Coast during the last decade (PFMC 1999, Sampson 1997, Ralston 1998, Bloeser 1999). One problem exacerbating these declines is insufficient stock assessments, especially for species of west coast rockfish (Family Scorpaenidae, Genus Sebastes) which comprise the core of...
    Resource Type:
    Capstone Project
    Full Text:
    marine reef fishes. J. Experimental Marine Biology and Ecology 146:113-137. Cowie, F. 1997, New

  • Perceptual thresholds for foot slipping in animated characters

    Creator:
    Strawn, Jordan J.
    Abstract:
    The computer game industry continues to progress toward realistic-looking character motion. However, even in state-of-the-art games, the use of motion capture data in character animation may result in errors such as “foot slipping,” where the feet do not match up with the floor properly during translation. Various algorithms have been...
    Resource Type:
    Honors College Thesis
    Full Text:
    Slipping in Animated Characters by Jordan J. Strawn A PROJECT submitted to Oregon State University

  • 2007 Review of PICES Publication Program

    Creator:
    Voss, Brian and Webster, Janet G.
    Abstract:
    This report was presented to the Finance and Administration Committee of PICES at the 16th Annual Meeting on October 31, 2007. It will appear as part of the Committee's annual report in the 2007 PICES Annual Report. Elements of the report were presented at the 33rd IAMSLIC Annual Conference with...
    Resource Type:
    Technical Report
    Full Text:
    publishers to extend the reach of PICES-related work. The PICES Finance and Administration (F&A) Committee

  • The face of Oregon's library community

    Creator:
    Webster, Janet G. and Cole, Maureen
    Abstract:
    One goal of the Oregon Library Association's Vision 2010 is to promote a strong and diverse workforce throughout all of the state's libraries. The forecasted shortage of librarians in the next decade prompted the OLA Board to request a demographic study of Oregon's libraries. A simple survey was adminstered at...
    Resource Type:
    Article
    Full Text:
    retiring baby-boomers. Monthly Labor Review, July 2000, pp. 17-25. 4. Hussar, William J. 1999

  • The role of CYP2E1 and CYP4A in the development of non-alcoholic steatohepatitis

    Creator:
    Hawkins, Jenna M.
    Abstract:
    Non-alcoholic Steatohepatitis (NASH) is an emerging form of liver disease associated with obesity, type II diabetes and dyslipidemia. As the prevalence of these metabolic conditions increases, so too has the occurrence of NASH in all sectors of the population. The pathology of this disease is similar to its alcoholic form,...
    Resource Type:
    Honors College Thesis
    Full Text:
    Genotype Gender Age Metabolic State WT F 10 weeks lean WT M 9 weeks lean CamK-cre M 10 weeks lean

  • Discovery and identification of antibacterial agents for dental use

    Creator:
    Kirkpatrick, Adam G.
    Abstract:
    Dental disease is a very prevalent and costly disease in which the symptoms, not the disease, are currently being treated. The disease is caused by pathogenic oral bacteria, many of which are a part of the Mutans Streptococci. The objective of this thesis was to find a natural substance that...
    Resource Type:
    Honors College Thesis
    Full Text:
    fluoride treatments every two weeks, the disease would not stop. [4] According to Walter J. Loesche in the

  • Expression of prolactin in feline mammary adenomas and adenocarcinomas

    Creator:
    Trummel, Danielle K.
    Abstract:
    Mammary tumors are the third most common tumor in cats after cutaneous neoplasia and lymphosarcoma. More than 80% of feline mammary tumors are adenocarcinomas, which are similar to human mammary adenocarcinomas in their biologic behavior and histologic characteristics. Despite treatment with radical mastectomy, feline mammary adenocarcinoma is associated with a...
    Resource Type:
    Undergraduate Thesis and Presentation
    Full Text:
    specificity of immunostaining was verified using a Universal negative antibody (B, F). Positive cytokeratin

  • Studies on a transgenic approach to decrease gliadin content in wheat

    Creator:
    Bell, Shannon M.
    Abstract:
    Celiac disease, an autoimmune response triggered by the consumption of seed storage proteins of cereals, affects an estimated 1% of the human population. In the case of wheat (Triticum aestivum L.), one of the world’s most consumed cereals, alcohol-soluble proteins, the gliadins, have been identified as the allergy-eliciting agents. Previous...
    Resource Type:
    Undergraduate Thesis
    Full Text:
    using a variety of PCR primers (Fig. 10). Primers RI_ANTI F (5’ CAAATTCTAATCCCCAATCCAA 3’) and RI_ANTI R

  • A bibliotherapy evaluation tool: grounding counselors in the therapeutic use of literature

    Creator:
    Pehrsson, Dale Elizabeth and McMillen, Paula S.
    Abstract:
    Discusses the development and evolution of the Bibliotherapy Evaluation Tool to help graduate counseling students use literature in therapy ethically and appropriately. A survey of bibliotherapeutic practice in the helping professions is provided. Graduate students showed greater knowledge of and comfort with bibliotherapy after exposure to a teaching module and...
    Resource Type:
    Article and Preprint
    Full Text:
    are stimulating, and possibilities abound. References Ackerson, J., Scogin, F., McKendree-Smith, N

  • Distribution and origin of organic matter preserved in modern surface sediments throughout Coastal SE Alaska

    Creator:
    Walinsky, Sarah E.
    Abstract:
    Twenty seven modern (top 1-2cm) sediment samples from multicores retrieved from throughout coastal SE Alaska were analyzed for their organic matter content and the source composition. Total organic carbon (TOC) as well as biogenic silica (bioSi), and calcium carbonate (CaCO3) content were analyzed to evaluate the organic matter content and...
    Resource Type:
    Honors College Thesis