Index Catalog // ScholarsArchive@OSU

Kinetics of synthesis and degradation of chicken liver xanthine dehydrogenase

Creator:: Epstein, Arnold
Abstract:: The role of synthesis and degradation in controlling enzyme concentrations was studied. Concentrations of chloride and arginine were determined for blood and liver at various stages of development from the embryo to the 8 day old chicken. The chloride concentrations were used to obtain the volume of extracellular blood in...
Resource Type:: Dissertation
Full Text:: Sakaguchi reaction by creatinine. 29 IV. Arginine and. valine pool sizes in liver and blood in the chick

An examination of kin and nonkin foster parents’ experiences

Creator:: De Costa, Jennifer L. (Jennifer Loretta)
Abstract:: The growth of foster care, particularly kin foster care has greatly outpaced our knowledge. The purpose of this exploratory qualitative study was to develop a more informed understanding of foster family functioning from the perspective of foster parents. This study examined the experiences of 9 kin and 12 nonkin foster...
Resource Type:: Dissertation

Effects of teaching games for understanding on game performance and understanding in middle school physical education

Creator:: Harvey, Stephen
Abstract:: Most students arrive at game-focused physical education (PE) with neither the skills nor the tactical knowledge to be successful (Metzler, 2000). Although the Teaching Games for Understanding (TGFU) approach can enhance both on- and off-the-ball skills in game play performance (Griffin et al., 1995; Harvey et al., in review, Harvey...
Resource Type:: Dissertation

Analysis of needs-based proposal for a workshop on coastal resources management for specialists from Mexico and the US

Creator:: Hobgood, Nick
Abstract:: Building institutional and human capacity for integrated coastal zone management (ICZM) is increasingly recognized as critical to the future of sustainable development in coastal states. Agenda 21 of the UNCED conference has underscored the urgency of capacity building for ICZM as have other international bodies such as the North American...
Resource Type:: Capstone Project
Date Created:

A Public Elementary School as a Cultural Context : Japanese Children Learning to Perceive their Environment

Creator:: Sugai, Taichi
Abstract:: This thesis examines the cultural context in which Japanese children are constructing their own perspective of the environment because in the development of environmental education in Japan, the perspectives of children and teachers have not been taken into consideration. Although educators have made efforts to give direction to environmental education,...
Resource Type:: Masters Thesis

A comprehensive evaluation of product quality in the Pacific Whiting (Merluccius productus) and Albacore tuna (thunnus alalunga) industries

Creator:: Greene, Elizabeth
Abstract:: In the highly competitive animal protein market, seafood faces increasing pressure to improve and standardize product quality. While there is general consensus that quality can be improved for many seafood products, there is little agreement on the types and levels of characteristics that should define "quality." This is a fundamental...
Resource Type:: Masters Thesis
Full Text:: (Sakaguchi and Koike, 1992). K-values measure the degradation of ATP into inosine monophosphate (IMP

Oregon women : a bio-bibliography

Creator:: Leasher, Evelyn M.
Abstract:: This index provides access to infonnation about women in 102 books and journals. The information contained in each entry is only as good as the original and the quality varies considerably. Much of this infonnation has not before been easily accesible in this form. My hope is that this index...
Resource Type:: Book
Full Text:: trade of the far West. Glendale, Calif., A.H. Clark Co., 1965-72. Vols 1-9. Hines, Harvey K. An

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Creator:: Bernier, Jeremiah C.
Abstract:: Chinook salmon (Oncorhynchus tshawytscha) display the greatest variability of return times to freshwater of all Pacific salmon. Differential return times to freshwater have segregated populations of Chinook into two broad types or runs, fall and spring, named for the time of year in which they migrate to freshwater. Migration time...
Resource Type:: Masters Thesis
Full Text:: olfactomedin 17 1182 CATGGCGGGGTGTGCTTTGTT 26 4 0 8.34 -6.86 uniquely absent Na/K ATPase alpha subunit

Identification of intracellular trafficking signals contained within the vaccinia virus F13L protein

Creator:: Honeychurch, Kady M.
Abstract:: The F13L protein is the major envelope antigen of vaccinia virus, the prototypic member of the Orthopoxvirus genus. F13L is 372 residues in length and is essential for the formation of wrapped forms of virus. F13L contains a number of potential functional domains including a palmitylation site, a phospholipase domain...
Resource Type:: Dissertation
Full Text:: ; Craven et al., 1999; Perez et al., 2003; Sakaguchi et al., 2005; Strecker et al., 2003). Vaccinia

Unrequired reading; an annotated bibliography for teachers & school administrators

Creator:: Tiedt, Iris M. and Tiedt, Sidney W.
Resource Type:: Book

ScholarsArchive@OSU

Kinetics of synthesis and degradation of chicken liver xanthine dehydrogenase

An examination of kin and nonkin foster parents’ experiences

Effects of teaching games for understanding on game performance and understanding in middle school physical education

Analysis of needs-based proposal for a workshop on coastal resources management for specialists from Mexico and the US

A Public Elementary School as a Cultural Context : Japanese Children Learning to Perceive their Environment

A comprehensive evaluation of product quality in the Pacific Whiting (Merluccius productus) and Albacore tuna (thunnus alalunga) industries

Oregon women : a bio-bibliography

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Identification of intracellular trafficking signals contained within the vaccinia virus F13L protein

Unrequired reading; an annotated bibliography for teachers & school administrators

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search