Index Catalog // ScholarsArchive@OSU

Creator:: Kanda, Kojun, Pflug, James M., Sproul, John S., Dasenko, Mark A., and Maddison, David R.
Abstract:: Correction: 7 Mar 2016: The PLOS ONE Staff (2016) Correction: Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing. PLOS ONE 11(3): e0151124. https://doi.org/10.1371/journal.pone.0151124
Resource Type:: Article
Full Text:: ., Sproul, J. S., Dasenko, M. A., & Maddison, D. R. (2015). Successful Recovery of Nuclear Protein-Coding

Creator:: Kaur, Navneet, Cooper, William Rodney, Duringer, Jennifer M., Badillo-Vargas, Ismael E., Esparza-Diaz, Gabriela, Rashed, Arash, and Horton, David R.
Abstract:: Plant species in the family Solanaceae are the usual hosts of potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Psylloidea: Triozidae). However, the psyllid has also been shown to develop on some species of Convolvulaceae (bindweeds and morning glories). Developmental success on Convolvulaceae is surprising given the rarity of psyllid species worldwide...
Resource Type:: Article
Full Text:: E. Badillo- Vargas4, Gabriela Esparza-Dı́az4¤, Arash Rashed1, David R. Horton2 1 Department of

Creator:: Tinetti, Mary E., Han, Ling, McAvay, Gail J., Lee, David S. H., Peduzzi, Peter, Dodson, John A., Gross, Cary P., Zhou, Bingqing, and Lin, Haiqun
Abstract:: Importance Randomized trials of anti-hypertensive treatment demonstrating reduced risk of cardiovascular events in older adults included participants with less comorbidity than clinical populations. Whether these results generalize to all older adults, most of whom have multiple chronic conditions, is uncertain. Objective To determine the association between anti-hypertensive medications and CV...
Resource Type:: Article
Full Text:: (5 1 .1 ) 7 6 4 (5 2 .5 ) 4 0 1 (5 4 .8 ) .0 3 4 (.0 5 5 ) C u rr e n t sm o ke r 6

Creator:: Garcia, Jonathan, Parker, Caroline, Parker, Richard G., Wilson, Patrick A., Philbin, Morgan M., and Hirsch, Jennifer S.
Abstract:: Black men who have sex with men (BMSM) experience among the highest rates of HIV infection in the United States. We conducted a community-based ethnography in New York City to identify the structural and environmental factors that influence BMSMs vulnerability to HIV and their engagement with HIV prevention services. Methods...
Resource Type:: Article
Full Text:: among Black Men Who Have Sex with Men Garcia, J., Parker, C., Parker, R. G., Wilson, P. A., Philbin, M

Creator:: Bonventre, Josephine A., Zielke, Ryszard A., Korotkov, Konstantin V., and Sikora, Aleksandra E.
Abstract:: A promising new drug target for the development of novel broad-spectrum antibiotics is the highly conserved small GTPase Obg (YhbZ, CgtA), a protein essential for the survival of all bacteria including Neisseria gonorrhoeae (GC). GC is the agent of gonorrhea, a prevalent sexually transmitted disease resulting in serious consequences on...
Resource Type:: Article
Full Text:: (MRSA)-f (GATCCCATGGTTGTCGATCAAGTCAAAATATC) and obg (MRSA)-r (GACTAAGCTTCGCTCCTATTCAACGAATT). The

Creator:: Jones, Kelly W. and Lewis, David J.
Abstract:: Deforestation and conversion of native habitats continues to be the leading driver of biodiversity and ecosystem service loss. A number of conservation policies and programs are implemented—from protected areas to payments for ecosystem services (PES)—to deter these losses. Currently, empirical evidence on whether these approaches stop or slow land cover...
Resource Type:: Article
Full Text:: -programmed codes in Stata or R. The new, matched, sample of treatment and control observations can then be

ScholarsArchive@OSU