Index Catalog // ScholarsArchive@OSU

LidarBoX: a 3D-printed, Open-source Altimeter System to Improve Photogrammetric Accuracy for off-the-shelf Drones

Creator:: Bierlich, K. C., Wengrove, Drummond, Bird, Clara N., Davidson, Robert, Chandler, Todd, Torres, Leigh G., and Cantor, Mauricio
Abstract:: Drones provide a privileged birds’-eye view for collecting high-resolution imagery formorphometric and behavioral sampling of animals. Biologically meaningful measurements extracted from overhead images require an accurate estimate of altitude, but current commercial drones include inaccurate barometer estimates. Recent proposals for coupling altimeter systems to drones have provided customized, open-source solutions,...
Resource Type:: Article
Full Text:: ow nl oa de d fr om c dn sc ie nc ep ub .c om b y O R E G O N S T A T E U N IV

Dualidad Cultural: Analyzing Bicultural Identity Integration and Implicit Biases

Creator:: Cabrera Martinez, Lianelys A.
Abstract:: This study aimed to investigate the relationship between bicultural identity integration and implicit attitudes among Latine bicultural individuals. We hypothesized that (a) those with high levels of blendedness and harmony in bicultural identity integration would exhibit fewer negative implicit racial attitudes, and conversely, (b) those with high levels of conflict...
Resource Type:: Masters Thesis
Full Text:: combination of biases and average response time (R^2Change = .02). Finally, correlation analysis indicated

Exploring the Lived Experiences of Women Trauma Counselors: Two Interpretative Phenomenological Analysis Studies Making Meaning of Specialization and Resilience

Creator:: Deeg-Davis, Michelle
Abstract:: The counseling profession has historically emphasized generalist practice, viewing specialization as a possible threat that could lend to fragmentation. Specialization is occurring within CACREP graduate programs (CACREP, 2016) through post-graduates focused on continuing education experiences and the professions’ acknowledgment of the importance of competence areas. Research has noted the importance...
Resource Type:: Dissertation
Full Text:: (Example of Data Analysis Steps 1 and 2) Appendix G: Manuscript 1 Personal Experiential Themes 178 (Data

Unveiling Climatic Niches for Deeper Insights into Invasion Potential and Enhanced Distribution Models of Freshwater Fishes

Creator:: Jan, Arif, Giannico, Guillermo, Arismendi, Ivan, and Fitcroft, Rebecca
Abstract:: Introduced species may exhibit variations in their preferred climatic niches between their native and introduced ranges, which can have important implications for the transferability of distribution models. In the Himalayan ecoregion, little is known about the geographic distribution and climatic niche overlap between native and introduced cold-water species. Here, we...
Resource Type:: Article
Full Text:: (https:// maps. F I G U R E 1 Study area map for all four species showing native and introduced ranges

Titanium Dioxide Nanomaterial Ink Production Through Laser Ablation Synthesis in Solution for Printed Electronics Applications

Creator:: Duryea, Devyn, McKibben, Nicholas, Manzi, Jacob, Brennan, Taylor, Subbaraman, Harish, Estrada, David, and Kandadai, Mirmala
Abstract:: Flexible and printed electronics have become increasingly popular as they make possible the production of flexible, low-cost, multifunction devices that are unachievable through traditional manufacturing methods. The printed films are significantly impacted and thus limited by the existing ink production process. Herein, an alternate technique of generating high-quality titanium dioxide...
Resource Type:: Article
Full Text:: , 095011. [27] V. Subramanian, J. Cen, A. de la Fuente Vornbrock, G. Grau, H. Kang, R. Kitsomboonloha, D

Registration of “Top Shelf” Barley: A Two-row, Winter Growth Habit, Malting Cultivar That Is a 2 Non-producer of Glycosidic Nitrile and Is of Interest to The North American Distilling Industry.

Creator:: Morrissy, Campbell P., Filichkin, Tanya, Fisk, Scott P., Helgerson, Laura, and Hayes, Patrick M.
Abstract:: ‘Top Shelf’ (Reg. no. XXX, PI YYYY), experimental designation DH162310, is a two-row winter barley (Hordeum vulgare L.) released by Oregon Agricultural Experiment Station in 2023. It is a malting cultivar that is known to be a non-producer of glycosidic nitrile (GN0). Glycosidic nitrile is the precursor to a regulated...
Resource Type:: Article
Full Text:: /plr2.20067 362 • Gous, P. W., Warren, F., Mo, O. W., Gilbert, R. G., & Fox, G. P. (2015). The effects of

Evaluating Streamflow and Temperature Effects on Bull Trout Migration and Survival with Linear Spatial Capture–Recapture Models

Creator:: Wohner, Patti J., Thurow, Russel F., and Peterson, James T.
Abstract:: Objective: In the U.S. Pacific Northwest, climate change is increasing air temperatures, decreasing warm season (April–September) streamflow, and increasing cool season (October–March) streamflow. Warmer water temperatures may alter conditions for migratory coldwater fishes like the Bull Trout Salvelinus confluentus. Consequently, an understanding of Bull Trout migration and survival is critical...
Resource Type:: Article
Full Text:: . F I G U R E 1 The Rapid River and Salmon River study area (blue outline) in western Idaho

Investigating heartworm infection in dogs : combining publicly available dog testing data with mosquito surveillance

Creator:: Easterday, Megan
Abstract:: Oregon dogs are susceptible to heartworm, Dirofilaria immitis, a parasitic roundworm. D. immitis infects the cardiopulmonary system and reproduce within the animal, growing up to 30 cm. Dirofilaria repens is a filarial nematode that infects dogs, cats, wolves, coyotes, sea lions, and muskrats. It is also spread by mosquitos and...
Resource Type:: Honors College Thesis
Full Text:: `) Amplicon Size (bp) COI-DIM-F Forward D. immitis TGCTGGTTTGCAAGGTATGC 89 COI-DIM-R Reverse D

Turbulence from Tropical Instability Waves in The Equatorial Cold Tongues: Quantification From Multiyear Moored Records

Creator:: Iyer, Suneil and Moum, James N.
Abstract:: Tropical instability waves (TIWs) are identified in three multiyear equatorial mooring records in Pacific and Atlantic cold tongues to evaluate how TIWs modulate turbulence. At 0◦ , 140 ◦W in the Pacific, TIWs are present in 43% of observations, and are associ ated with elevated vertical shear and a 40%...
Resource Type:: Article
Full Text:: ). Averaged profiles at 140◦W (black; a-f), 23◦W (red; g-l), and 10◦W (blue; m-r) of (a,g,m) N2, (b,h,n) Sh2

“Red Light, Yellow Light!”: Evaluating the Anti-Listerial Potential of Bacillus Isolate Metabolites Using a High-Throughput Chromogenic Assay”

Creator:: Johnson, Taylor S.
Abstract:: Listeria monocytogenes contamination continues to pose challenges for the food industry and there is demand for effective methods of food preservation and protection that can also be considered clean label. A promising source of antilisterial compounds may be sourced from bacteria that produce novel byproducts. Ribosomally synthesized and post-translationally modified...
Resource Type:: Masters Thesis
Full Text:: same style, stored over five weeks time at 7°C. ………..188 Figure G-1. Thermal treatment of Bacillus

ScholarsArchive@OSU

LidarBoX: a 3D-printed, Open-source Altimeter System to Improve Photogrammetric Accuracy for off-the-shelf Drones

Dualidad Cultural: Analyzing Bicultural Identity Integration and Implicit Biases

Exploring the Lived Experiences of Women Trauma Counselors: Two Interpretative Phenomenological Analysis Studies Making Meaning of Specialization and Resilience

Unveiling Climatic Niches for Deeper Insights into Invasion Potential and Enhanced Distribution Models of Freshwater Fishes

Titanium Dioxide Nanomaterial Ink Production Through Laser Ablation Synthesis in Solution for Printed Electronics Applications

Registration of “Top Shelf” Barley: A Two-row, Winter Growth Habit, Malting Cultivar That Is a 2 Non-producer of Glycosidic Nitrile and Is of Interest to The North American Distilling Industry.

Evaluating Streamflow and Temperature Effects on Bull Trout Migration and Survival with Linear Spatial Capture–Recapture Models

Investigating heartworm infection in dogs : combining publicly available dog testing data with mosquito surveillance

Turbulence from Tropical Instability Waves in The Equatorial Cold Tongues: Quantification From Multiyear Moored Records

“Red Light, Yellow Light!”: Evaluating the Anti-Listerial Potential of Bacillus Isolate Metabolites Using a High-Throughput Chromogenic Assay”

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Conference Name

Conference Section/Track

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Funding Body

Language

License

Location

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search