Search Constraints
Filtering by:
Creator
Palo, Daniel R.
Remove constraint Creator: Palo, Daniel R.
Date
Unknown
Remove constraint Date: Unknown
« Previous |
1 - 100 of 369
|
Next »
Number of results to display per page
Search Results
-
- Creator:
- Davis, Loren G., Bean, Daniel W., Nyers, Alexander J., and Brauner, David R.
- Abstract:
- Here, we describe and demonstrate a geographic information systems-based lithic morphometric research (GLiMR) software approach. GLiMR accurately and rapidly handles a sequence of ArcGIS procedures to extract geometric morphometric data from 2D and 3D scan files of lithic artifacts. GLiMR generates three main types of geometric properties: shape data, topographic...
-
- Creator:
- Davis, Loren G., Bean, Daniel W., Nyers, Alexander J., and Brauner, David R.
- Abstract:
- Here, we describe and demonstrate a geographic information systems-based lithic morphometric research (GLiMR) software approach. GLiMR accurately and rapidly handles a sequence of ArcGIS procedures to extract geometric morphometric data from 2D and 3D scan files of lithic artifacts. GLiMR generates three main types of geometric properties: shape data, topographic...
-
- Creator:
- Davis, Loren G., Bean, Daniel W., Nyers, Alexander J., and Brauner, David R.
- Abstract:
- Here, we describe and demonstrate a geographic information systems-based lithic morphometric research (GLiMR) software approach. GLiMR accurately and rapidly handles a sequence of ArcGIS procedures to extract geometric morphometric data from 2D and 3D scan files of lithic artifacts. GLiMR generates three main types of geometric properties: shape data, topographic...
-
- Creator:
- Johnson, George Daniel
- Full Text:
- quadrangle, Oregon trE0LO*f 0Ir '${S $$}U&WBSt' ',}I}r,}t'Iffi AJ,Y$IID i,*KS tHil$E I.jJIASHAI{0LIi:. CIR
-
- Creator:
- Mulligan, Daniel M.
- Abstract:
- The rugged Cascade Range of central Oregon has been long regarded as an enigmatic, archaeological puzzle in the study of the Pacific Northwest's ancient past. While ethnographic and archaeological research in the adjacent northern Great Basin, Columbia Plateau and Willamette Valley have revealed a rich and ancient tapestry of Native...
- Full Text:
- ' A i I I - 01-03G IL r 3! ■ ' 17 L. • 91 10 • ti3 1114 .744. 1 I Ili 9 Basal-Notched
-
- Creator:
- Sarewitz, Daniel R.
- Abstract:
- Metamorphosed volcanogenic rocks of the Permian and Triassic Seven Devils Group are exposed in the northern part of the Heavens Gate 7.5 minute quadrangle, western Idaho. These rocks originated in a volcanic arc at a destructive plate margin. In the north, rocks that probably belong to the Lower Permian Hunsaker...
-
- Creator:
- Sarewitz, Daniel R.
- Abstract:
- Metamorphosed volcanogenic rocks of the Permian and Triassic Seven Devils Group are exposed in the northern part of the Heavens Gate 7.5 minute quadrangle, western Idaho. These rocks originated in a volcanic arc at a destructive plate margin. In the north, rocks that probably belong to the Lower Permian Hunsaker...
-
- Creator:
- Sarewitz, Daniel R.
- Abstract:
- Metamorphosed volcanogenic rocks of the Permian and Triassic Seven Devils Group are exposed in the northern part of the Heavens Gate 7.5 minute quadrangle, western Idaho. These rocks originated in a volcanic arc at a destructive plate margin. In the north, rocks that probably belong to the Lower Permian Hunsaker...
-
- Creator:
- Sarewitz, Daniel R.
- Abstract:
- Metamorphosed volcanogenic rocks of the Permian and Triassic Seven Devils Group are exposed in the northern part of the Heavens Gate 7.5 minute quadrangle, western Idaho. These rocks originated in a volcanic arc at a destructive plate margin. In the north, rocks that probably belong to the Lower Permian Hunsaker...
-
- Creator:
- Mumford, Daniel Franklin
- Abstract:
- The middle Eocene Tillamook Volcanics form the oldest rock unit in the Elsie-lower Nehalem River area. K-Ar age determinations and age constraints imposed by foraminiferal and calcareous nannofossil assemblages of overlying sedimentary strata indicate an absolute age of about 42 Ma for the uppermost Tillamook Volcanics. Major oxide values indicate...
-
- Creator:
- Mumford, Daniel Franklin
- Abstract:
- The middle Eocene Tillamook Volcanics form the oldest rock unit in the Elsie-lower Nehalem River area. K-Ar age determinations and age constraints imposed by foraminiferal and calcareous nannofossil assemblages of overlying sedimentary strata indicate an absolute age of about 42 Ma for the uppermost Tillamook Volcanics. Major oxide values indicate...
-
- Creator:
- Mumford, Daniel Franklin
- Abstract:
- The middle Eocene Tillamook Volcanics form the oldest rock unit in the Elsie-lower Nehalem River area. K-Ar age determinations and age constraints imposed by foraminiferal and calcareous nannofossil assemblages of overlying sedimentary strata indicate an absolute age of about 42 Ma for the uppermost Tillamook Volcanics. Major oxide values indicate...
-
- Creator:
- Mumford, Daniel Franklin
- Abstract:
- The middle Eocene Tillamook Volcanics form the oldest rock unit in the Elsie-lower Nehalem River area. K-Ar age determinations and age constraints imposed by foraminiferal and calcareous nannofossil assemblages of overlying sedimentary strata indicate an absolute age of about 42 Ma for the uppermost Tillamook Volcanics. Major oxide values indicate...
-
- Creator:
- Wisdom, Daniel W.
- Abstract:
- Light plays an important role in ecological processes in the ocean both day and night. While relatively inexpensive, off the shelf instruments are available to measure Photosynthetically Active Radiation or PAR during the day, efforts to quantify light levels at night have proven more difficult. The goal of this work...
- Resource Type:
- Research Paper
- Full Text:
- Night and Crepuscular Periods Daniel W. Wisdom Project Report
-
- Creator:
- Mulligan, Daniel M.
- Abstract:
- The rugged Cascade Range of central Oregon has been long regarded as an enigmatic, archaeological puzzle in the study of the Pacific Northwest's ancient past. While ethnographic and archaeological research in the adjacent northern Great Basin, Columbia Plateau and Willamette Valley have revealed a rich and ancient tapestry of Native...
- Full Text:
- g8 "a 1.1t EE m0! 1401 E I [ 1i G E e 4 Zq o p 1 •. s s c • m 1.8 .0 , a 4i r a g e l
-
- Creator:
- Olson, Daniel J.
- Abstract:
- The Santa Barbara-Montecito and Goleta basins are structurally continuous fault-controlled Pleistocene basins containing up to 3000 feet (925 m) of marine Pleistocene Santa Barbara Formation which were deposited on previously deformed Sisquoc and older strata. Structures subcropping against the unconformity at the base of the Santa Barbara Formation show that...
- Full Text:
- -Goleta metropolitan area, Santa Barbara County, California AN ABSTRACT OF THE THESIS OF Olson, Daniel
-
- Creator:
- Eungard, Daniel W.
- Abstract:
- Silicic volcanism in the central Oregon Cascade range has decreased in both the size and frequency of eruptions from its initiation at ~40 Ma to present. The reasons for this reduction in silicic volcanism are poorly constrained. Studies of the petrogenesis of these magmas have the potential for addressing this...
- Full Text:
- AN ABSTRACT OF THE THESIS OF Daniel W. Eungard
-
- Creator:
- Nachman, Daniel Alexander
- Abstract:
- The Duzel Rock area includes four square miles in the eastern Paleozoic subprovince of the Klamath Mountains southeast of Fort Jones, California. The structurally complex terraine is composed of Silurian graywacke, post-Silurian phyllite, limestone and basalt associations, and minor andesitic intrusive rocks. Three groups of sedimentary and extrusive rocks have...
- Full Text:
- , California AN ABSTRACT OF THE THESIS OF DANIEL ALEXANDER NACHMAN for the degree of Master of Science in
-
- Creator:
- Mulligan, Daniel M.
- Abstract:
- The rugged Cascade Range of central Oregon has been long regarded as an enigmatic, archaeological puzzle in the study of the Pacific Northwest's ancient past. While ethnographic and archaeological research in the adjacent northern Great Basin, Columbia Plateau and Willamette Valley have revealed a rich and ancient tapestry of Native...
- Full Text:
- AN ABSTRACT OF THE THESIS OF Daniel M. Mulligan for the
-
- Creator:
- Tyler, Daniel Jr and Barnes, Jeffrey R.
- Abstract:
- Modeling of slope flow circulations in idealized axisymmetric craters is used to understand (1) the large surface pressure amplitude observed in Gale Crater by the Rover Environmental Monitoring Station and (2) the shallow convective boundary layer (CBL) suggested by Curiosity imagery. Air temperatures vary within craters with greater amplitudes than...
- Full Text:
- and the depth of the convective boundary layer Daniel Tyler Jr.1 and Jeffrey R. Barnes1 1College of
-
- Creator:
- Tyler, Daniel Jr and Barnes, Jeffrey R.
- Abstract:
- Modeling of slope flow circulations in idealized axisymmetric craters is used to understand (1) the large surface pressure amplitude observed in Gale Crater by the Rover Environmental Monitoring Station and (2) the shallow convective boundary layer (CBL) suggested by Curiosity imagery. Air temperatures vary within craters with greater amplitudes than...
- Full Text:
- 1Daniel Tyler, Jr and 1Jeffrey R. Barnes 1College of Earth Ocean and Atmospheric Science, Oregon State
-
- Creator:
- Petersen-Perlman, Jacob Daniel
- Abstract:
- How does transboundary water cooperation begin at the initial stages? Countries in many transboundary basins either do not cooperate at all or have ceased cooperation altogether. Yet cooperation does often prevail, resulting in 688 water-related treaties signed between 1820 and 2007. The question we address here is, by which practices...
-
- Creator:
- Schooler, Deborah and Daniels, Elizabeth A.
- Abstract:
- Using a quasi-experimental design, 118 Latina girls, ages 13-18, viewed five color photographs of White women. Girls viewed either images of sexualized women or images of non-sexualized women. After viewing the images, girls were asked to complete the sentence stem, “I am…” 20 times. Thirty percent of girls spontaneously described...
- Full Text:
- masculine and feminine ideals. Journal of Psychology, 132, 87-94. Buriel, R. (1987). Ethnic labeling and
-
- Creator:
- Vinueza, Luis R., Menge, Bruce A., Ruiz, Diego, and Palacios, Daniel M.
- Abstract:
- The impact of herbivores on primary producers in differing oceanographic regimes is a matter of intense ecological interest due to ongoing changes in their abundance, that of their predators, and anthropomorphic alteration of nutrient cycles and climatic patterns. Interactions between productivity and herbivory in marine habitats have been studied on...
- Full Text:
- Archives M084-014-A1 Luis R. Vinueza, Bruce A. menge, Diego Ruiz, and Daniel M. Palacios. 2014
-
- Creator:
- Vinueza, Luis R., Menge, Bruce A., Ruiz, Diego, and Palacios, Daniel M.
- Abstract:
- The impact of herbivores on primary producers in differing oceanographic regimes is a matter of intense ecological interest due to ongoing changes in their abundance, that of their predators, and anthropomorphic alteration of nutrient cycles and climatic patterns. Interactions between productivity and herbivory in marine habitats have been studied on...
- Full Text:
- Archives M084-014-A2 Luis R. Vinueza, Bruce A. menge, Diego Ruiz, and Daniel M. Palacios. 2014
-
- Creator:
- Vinueza, Luis R., Menge, Bruce A., Ruiz, Diego, and Palacios, Daniel M.
- Abstract:
- The impact of herbivores on primary producers in differing oceanographic regimes is a matter of intense ecological interest due to ongoing changes in their abundance, that of their predators, and anthropomorphic alteration of nutrient cycles and climatic patterns. Interactions between productivity and herbivory in marine habitats have been studied on...
- Full Text:
- Galápagos intertidal meta-ecosystem LUIS R. VINUEZA,1,2 BRUCE A. MENGE,2,7 DIEGO RUIZ,3,4 AND DANIEL M
-
- Creator:
- McCulloh, Katherine A., Johnson, Daniel M., Meinzer, Frederick C., and Woodruff, David R.
- Abstract:
- Recent work has suggested that plants differ in their relative reliance on structural avoidance of embolism versus maintenance of the xylem water column through dynamic traits such as capacitance, but we still know little about how and why species differ along this continuum. It is even less clear how or...
- Full Text:
- , D. R. (2014), The dynamic pipeline: hydraulic capacitance and xylem hydraulic safety in four tall
-
- Creator:
- Teeguarden, Justin G., Twaddle, Nathan C., Churchwell, Mona I., and Doerge, Daniel R.
- Abstract:
- Despite its very low oral bioavailability and rapid elimination, multiple reports of unexpectedly high bisphenol A (BPA) concentrations in the serum of pregnant mothers or cord blood have raised questions about BPA exposures during pregnancy. Thirty healthy pregnant women recruited to the study were evaluated for total BPA exposure over...
-
- Creator:
- Teeguarden, Justin G., Twaddle, Nathan C., Churchwell, Mona I., and Doerge, Daniel R.
- Abstract:
- Despite its very low oral bioavailability and rapid elimination, multiple reports of unexpectedly high bisphenol A (BPA) concentrations in the serum of pregnant mothers or cord blood have raised questions about BPA exposures during pregnancy. Thirty healthy pregnant women recruited to the study were evaluated for total BPA exposure over...
-
- Creator:
- Teeguarden, Justin G., Twaddle, Nathan C., Churchwell, Mona I., and Doerge, Daniel R.
- Abstract:
- Despite its very low oral bioavailability and rapid elimination, multiple reports of unexpectedly high bisphenol A (BPA) concentrations in the serum of pregnant mothers or cord blood have raised questions about BPA exposures during pregnancy. Thirty healthy pregnant women recruited to the study were evaluated for total BPA exposure over...
-
- Creator:
- Teeguarden, Justin G., Twaddle, Nathan C., Churchwell, Mona I., and Doerge, Daniel R.
- Abstract:
- Despite its very low oral bioavailability and rapid elimination, multiple reports of unexpectedly high bisphenol A (BPA) concentrations in the serum of pregnant mothers or cord blood have raised questions about BPA exposures during pregnancy. Thirty healthy pregnant women recruited to the study were evaluated for total BPA exposure over...
-
- Creator:
- Teeguarden, Justin G., Twaddle, Nathan C., Churchwell, Mona I., and Doerge, Daniel R.
- Abstract:
- Despite its very low oral bioavailability and rapid elimination, multiple reports of unexpectedly high bisphenol A (BPA) concentrations in the serum of pregnant mothers or cord blood have raised questions about BPA exposures during pregnancy. Thirty healthy pregnant women recruited to the study were evaluated for total BPA exposure over...
-
- Creator:
- Teeguarden, Justin G., Twaddle, Nathan C., Churchwell, Mona I., and Doerge, Daniel R.
- Abstract:
- Despite its very low oral bioavailability and rapid elimination, multiple reports of unexpectedly high bisphenol A (BPA) concentrations in the serum of pregnant mothers or cord blood have raised questions about BPA exposures during pregnancy. Thirty healthy pregnant women recruited to the study were evaluated for total BPA exposure over...
-
- Creator:
- McCulloh, Katherine A., Johnson, Daniel M., Meinzer, Frederick C., and Woodruff, David R.
- Abstract:
- Recent work has suggested that plants differ in their relative reliance on structural avoidance of embolism versus maintenance of the xylem water column through dynamic traits such as capacitance, but we still know little about how and why species differ along this continuum. It is even less clear how or...
-
- Creator:
- Gordon, Daniel V and Ssebisubi, Maurice
- Abstract:
- The purpose of this article is to report the results of a statistical investigation of links in the fish supply chain in Uganda. We are particularly interested in the extent of ex-vessel prices impacting links downstream in the fish supply chain. We test for vertical and horizontal co-integration for five...
- Full Text:
- UGANDAN FISH SUPPLY CHAIN: MEASURING FOR FEEDBACK EFFECTS TO FISHERMEN Daniel V. Gordon
-
- Creator:
- Blatt, Daniel S., Erickson, Gregory, and Bernieri, Frank
- Abstract:
- Autism and Alexithymia are two disorders characterized by deficiencies in interpersonal and emotional processing. For example, both of these disorders are associated with deficits in the ability to identify and judge the emotions of others. For diagnosis, patients are typically assessed for such deficiencies using published tests of emotion perception...
- Full Text:
- r r r r
-
- Creator:
- Blatt, Daniel S., Erickson, Gregory, and Bernieri, Frank
- Abstract:
- Autism and Alexithymia are two disorders characterized by deficiencies in interpersonal and emotional processing. For example, both of these disorders are associated with deficits in the ability to identify and judge the emotions of others. For diagnosis, patients are typically assessed for such deficiencies using published tests of emotion perception...
- Full Text:
- r r r r
-
- Creator:
- Irvine, Ladd M., Mate, Bruce R., Winsor, Martha H., Palacios, Daniel M., Bograd, Steven J., Costa, Daniel P., and Bailey, Helen
- Abstract:
- Mortality and injuries caused by ship strikes in U.S. waters are a cause of concern for the endangered population of blue whales (Balaenoptera musculus) occupying the eastern North Pacific. We sought to determine which areas along the U.S. West Coast are most important to blue whales and whether those areas...
- Full Text:
- Ladd M. Irvine1*, Bruce R. Mate1, Martha H. Winsor1, Daniel M. Palacios2,3¤, Steven J. Bograd3, Daniel
-
- Creator:
- Irvine, Ladd M., Mate, Bruce R., Winsor, Martha H., Palacios, Daniel M., Bograd, Steven J., Costa, Daniel P., and Bailey, Helen
- Abstract:
- Mortality and injuries caused by ship strikes in U.S. waters are a cause of concern for the endangered population of blue whales (Balaenoptera musculus) occupying the eastern North Pacific. We sought to determine which areas along the U.S. West Coast are most important to blue whales and whether those areas...
-
- Creator:
- Kelly, Terra R., Grantham, Jesse, George, Daniel, Rivers, James W., and et al.
- Abstract:
- Large-scale poisoning events are common to scavenging bird species that forage communally, many of which are in decline. To reduce the threat of poisoning and compensate for other persistent threats, management, including supplemental feeding, is ongoing for many reintroduced and endangered vulture populations. Through a longitudinal study of lead exposure...
- Full Text:
- Reintroduction TERRA R. KELLY,∗ JESSE GRANTHAM,† DANIEL GEORGE,‡ *** ALACIA WELCH,‡ JOSEPH BRANDT,† L. JOSEPH
-
- Creator:
- Nadeau, Daniel F., Pardyjak, Eric R., Higgins, Chad W., Huwald, Hendrik, and Parlange, Marc B.
- Abstract:
- A field campaign, the Slope Experiment near La Fouly (SELF-2010), was conducted to monitor the evening transition of slope flows on clear-sky days from July to September 2010 in a narrow valley of the Swiss Alps. A steep west-facing slope with inclinations ranging from 25° to 45° was instrumented from...
- Full Text:
- slopes 1 Flow during the evening transition over steep alpine slopes Daniel F. Nadeaua,b∗, Eric R
-
- Creator:
- Nadeau, Daniel F., Pardyjak, Eric R., Higgins, Chad W., Huwald, Hendrik, and Parlange, Marc B.
- Abstract:
- A field campaign, the Slope Experiment near La Fouly (SELF-2010), was conducted to monitor the evening transition of slope flows on clear-sky days from July to September 2010 in a narrow valley of the Swiss Alps. A steep west-facing slope with inclinations ranging from 25° to 45° was instrumented from...
- Full Text:
- Flow during the evening transition over steep Alpine slopes Daniel F. Nadeau,a,b* Eric R. Pardyjak,c
-
- Creator:
- Kelly, Terra R., Grantham, Jesse, George, Daniel, Rivers, James W., and et al.
- Abstract:
- Large-scale poisoning events are common to scavenging bird species that forage communally, many of which are in decline. To reduce the threat of poisoning and compensate for other persistent threats, management, including supplemental feeding, is ongoing for many reintroduced and endangered vulture populations. Through a longitudinal study of lead exposure...
-
- Creator:
- Gruss, Daniel, Velizhanin, Kirill A., and Zwolak, Michael
- Abstract:
- Landauer’s formula is the standard theoretical tool to examine ballistic transport in nano- and meso-scale junctions, but it necessitates that any variation of the junction with time must be slow compared to characteristic times of the system, e.g., the relaxation time of local excitations. Transport through structurally dynamic junctions is,...
- Full Text:
- ’ crossover in electronic transport – Supplemental Information Daniel Gruss,1, 2, 3 Kirill A. Velizhanin,4
-
- Creator:
- Gruss, Daniel, Velizhanin, Kirill A., and Zwolak, Michael
- Abstract:
- Landauer’s formula is the standard theoretical tool to examine ballistic transport in nano- and meso-scale junctions, but it necessitates that any variation of the junction with time must be slow compared to characteristic times of the system, e.g., the relaxation time of local excitations. Transport through structurally dynamic junctions is,...
- Full Text:
- electronic transport Daniel Gruss1,2,3, Kirill A. Velizhanin4 & Michael Zwolak1 Landauer’s formula is the
-
- Creator:
- Blatt, Daniel S., Erickson, Gregory, and Bernieri, Frank
- Abstract:
- Autism and Alexithymia are two disorders characterized by deficiencies in interpersonal and emotional processing. For example, both of these disorders are associated with deficits in the ability to identify and judge the emotions of others. For diagnosis, patients are typically assessed for such deficiencies using published tests of emotion perception...
- Full Text:
- ) to generate r-values, comparing all test scores to assess whether high performance on some tests
-
- Creator:
- Blatt, Daniel S., Erickson, Gregory, and Bernieri, Frank
- Abstract:
- Autism and Alexithymia are two disorders characterized by deficiencies in interpersonal and emotional processing. For example, both of these disorders are associated with deficits in the ability to identify and judge the emotions of others. For diagnosis, patients are typically assessed for such deficiencies using published tests of emotion perception...
- Full Text:
- ) to generate r-values, comparing all test scores to assess whether high performance on some tests
-
- Creator:
- Mi, Gu, Di, Yanming, and Schafer, Daniel W.
- Abstract:
- This work is about assessing model adequacy for negative binomial (NB) regression, particularly (1) assessing the adequacy of the NB assumption, and (2) assessing the appropriateness of models for NB dispersion parameters. Tools for the first are appropriate for NB regression generally; those for the second are primarily intended for...
- Full Text:
- *, Yanming Di1,2, Daniel W. Schafer1 1Department of Statistics, Oregon State University, Corvallis, Oregon
-
- Creator:
- Oregon State University. Extension Service and Edge, Daniel
- Abstract:
- Discusses the benefits and problems of introducing aquatic organisms into an area beyond their normal range as a result of human activities.
- Full Text:
- Osterman-Sussman, Oregon State University. (FILE: AQUA INTROS (R) ) Shots of a river or a lake, or a few
-
- Creator:
- Conway, Flaxen, Stefanovich, Maria, Stevenson, John, Yin, Yao, Campbell, Holly V., Hunter, Daniel A., and Covell, Zack
- Abstract:
- In 2007, the Oregon Wave Energy Trust (OWET) put out a request for proposals to begin to discover answers to many of the environmental and human dimensions questions. A multidisciplinary group of social scientists – Flaxen Conway, Brent Steel, Michael Harte, and Bryan Tilt, Oregon State University – responded to...
- Full Text:
- students – five masters candidates (Holly Campbell, John Stevenson, Zack Covell, Daniel Hunter, and Yao
-
- Creator:
- Conway, Flaxen, Stefanovich, Maria, Stevenson, John, Yin, Yao, Campbell, Holly V., Hunter, Daniel A., and Covell, Zack
- Abstract:
- In 2007, the Oregon Wave Energy Trust (OWET) put out a request for proposals to begin to discover answers to many of the environmental and human dimensions questions. A multidisciplinary group of social scientists – Flaxen Conway, Brent Steel, Michael Harte, and Bryan Tilt, Oregon State University – responded to...
- Full Text:
- Impacts of Wave Energy in Coastal Oregon Communities By Daniel Hunter, MA Applied Anthropology, Oregon
-
- Creator:
- Burnett, Jeffrey R.
- Abstract:
- Renibacterium salmoninarum is the causative agent of bacterial kidney disease in both wild and farmed salmonid species worldwide. The genome of this pathogen has significant synteny to the ubiquitous, soil-dwelling Arthrobacter spp. though it is 1.9 Mb smaller, suggesting that reductive evolution has occurred. Recently, our group finished sequencing and...
- Full Text:
- Renibacterium salmoninarum Genes in Infected Salmonids by Jeffrey R. Burnett A THESIS
-
- Creator:
- Braun, Lindsay R.
- Abstract:
- This thesis explores a three month period that I spent abroad working in medical clinics and hospitals in Ecuador. My work was conducted in three distinct areas: the urban landscape of Quito, Ecuador’s capital; Puyo, a small town bordering the Amazonian rainforest; and a small community located in the heart...
- Full Text:
- , cooking, and cleaning for the students in her house, which could hold up to seven. Of the four, Daniel and
-
- Creator:
- Garbarino, Angelina R.
- Abstract:
- This paper addresses how the implementation of North American Free Trade Agreement (NAFTA) has affected the use of Information Technology (IT) in Mexico. In order to answer this question this thesis analyzes the direct and indirect effects of NAFTA on Mexico’s economic and regulatory environment, and how this influences the...
- Full Text:
- technicians and engineers. Third generation Maquiladora firms are focused on R&D, relying on skilled labor
-
- Creator:
- Schnur, Susan R.
- Abstract:
- The spatial distribution and geologic histories of submarine volcanoes provide insight into submarine eruptive behavior, deep earth processes and plate tectonics. This dissertation examines the evolution of individual submarine volcanic edifices as well as linear trails of seamounts at three spatial and temporal scales. In order to understand constructive and...
- Full Text:
- dissertation would probably not have happened. Most importantly I would like to recognize my friends Daniel
-
- Creator:
- Gregory, Alex R.
- Abstract:
- Archaeological investigations at the Cooper's Ferry site in Western Idaho have recovered cultural remains dating to 16,000 years ago, suggesting the oldest human occupation recorded in North America. However, many archaeologists have argued the initial peopling of North America occurred no earlier than the opening of an ice-free corridor between...
- Resource Type:
- Masters Thesis
- Full Text:
- ) ……………….. 174 G r e g o r y | 1 1. Introduction 1.1. The Archaeological Implications and
-
- Creator:
- Joseph, Maxwell B., Preston, Daniel Lucas, and Johnson, Pieter T. J.
- Abstract:
- Understanding the drivers of species occurrence is a fundamental goal in basic and applied ecology. Occupancy models have emerged as a popular approach for inferring species occurrence because they account for problems associated with imperfect detection in field surveys. Current models, however, are limited because they assume covariates are independent...
- Full Text:
- Maxwell B. Joseph,1,3 Daniel l. preston,2 anD pieter t. J. Johnson1 1Department of Ecology and
-
- Resource Type:
- Article
- Full Text:
- k e r B r o w s e A ‐ Z J o u r n a l s T a g s H e l p Search launch
-
- Creator:
- Garcia, Maria O., Smith, Jane E., Luoma, Daniel L., and Jones, Melanie D.
- Abstract:
- Forest ecosystems of the Pacific Northwest of the USA are changing as a result of climate change. Specifically, rise of global temperatures, decline of winter precipitation, earlier loss of snowpack, and increased summer drought are altering the range of Pinus contorta. Simultaneously, flux in environmental conditions within the historic P....
- Full Text:
- . Garcia1,2 & Jane E. Smith3 & Daniel L. Luoma1 & Melanie D. Jones4 Received: 4 September 2014 /Accepted: 29
-
- Creator:
- Hartung, Daniel M., Bourdette, Dennis N., Ahmed, Sharia M., and Whitham, Ruth H.
- Abstract:
- Objective: To examine the pricing trajectories in the United States of disease-modifying therapies (DMT) for multiple sclerosis (MS) over the last 20 years and assess the influences on rising prices. Methods: We estimated the trend in annual drug costs for 9 DMTs using published drug pricing data from 1993 to...
- Full Text:
- in the US and the pharmaceutical industry: Too big to fail?” John R. Tischner, a patient with
-
- Creator:
- Murdiyarso, Daniel, Purbopuspito, Joko, Kauffman, J. Boone, and et al.
- Abstract:
- Mangroves provide a wide range of ecosystem services, including nutrient cycling, soil formation, wood production, fish spawning grounds, ecotourism and carbon (C) storage¹. High rates of tree and plant growth, coupled with anaerobic, water-logged soils that slow decomposition, result in large long-term C storage. Given their global significance as large...
- Full Text:
- climate change mitigation Daniel Murdiyarso1,2*, Joko Purbopuspito1,3, J. Boone Kau�man4, MatthewW.Warren5
-
- Creator:
- Joseph, Maxwell B., Preston, Daniel Lucas, and Johnson, Pieter T. J.
- Abstract:
- Understanding the drivers of species occurrence is a fundamental goal in basic and applied ecology. Occupancy models have emerged as a popular approach for inferring species occurrence because they account for problems associated with imperfect detection in field surveys. Current models, however, are limited because they assume covariates are independent...
- Full Text:
- 0.6 0 10 20 30 0 10 20 30 0 10 20 30 Estimated among-refuge standard deviation P os te rio r d en
-
- Creator:
- Hartung, Daniel M., Bourdette, Dennis N., Ahmed, Sharia M., and Whitham, Ruth H.
- Abstract:
- Objective: To examine the pricing trajectories in the United States of disease-modifying therapies (DMT) for multiple sclerosis (MS) over the last 20 years and assess the influences on rising prices. Methods: We estimated the trend in annual drug costs for 9 DMTs using published drug pricing data from 1993 to...
- Full Text:
- industry: Too big to fail? Hartung, D. M., Bourdette, D. N., Ahmed, S. M., & Whitham, R. H. (2015). The
-
- Creator:
- Murdiyarso, Daniel, Purbopuspito, Joko, Kauffman, J. Boone, and et al.
- Abstract:
- Mangroves provide a wide range of ecosystem services, including nutrient cycling, soil formation, wood production, fish spawning grounds, ecotourism and carbon (C) storage¹. High rates of tree and plant growth, coupled with anaerobic, water-logged soils that slow decomposition, result in large long-term C storage. Given their global significance as large...
- Full Text:
- Indonesian mangrove forests for global climate change mitigation Daniel Murdiyarso 1,8*, Joko
-
- Creator:
- Austin, Daniel, Cross, Robin M., Hayes, Tamara, and Kaye, Jeffrey
- Abstract:
- Fundamental laws governing human mobility have many important applications such as forecasting and controlling epidemics or optimizing transportation systems. These mobility patterns, studied in the context of out of home activity during travel or social interactions with observations recorded from cell phone use or diffusion of money, suggest that in...
- Full Text:
- Regularity and Predictability of Human Mobility in Personal Space Daniel Austin1*, Robin M. Cross2, Tamara
-
- Creator:
- Hartung, Daniel M., Middleton, Luke, Markwardt, Sheila, Williamson, Kaylee, and Ketchum, Kathy
- Abstract:
- PURPOSE: In February 2010, the US Food and Drug Administration (FDA) issued new recommendations for the safe use of long-acting beta agonists (LABA) in those with asthma. The objective of this study was to determine the impact of the FDA’s 2010 LABA advisory on LABA utilization. METHODS: Using administrative data...
- Full Text:
- Journal of allergy and 281 clinical immunology 2006;117:40-4. 282 3. Castle W, Fuller R, Hall J
-
- Creator:
- Smith, Daniel P., Thrash, J. Cameron, Nicora, Carrie D., Lipton, Mary S., Burnum-Johnson, Kristin E., Carini, Paul, Smith, Richard D., and Giovannoni, Stephen J.
- Abstract:
- Nitrogen is one of the major nutrients limiting microbial productivity in the ocean, and as a result, most marine microorganisms have evolved systems for responding to nitrogen stress. The highly abundant alphaproteobacterium “Candidatus Pelagibacter ubique,” a cultured member of the order Pelagibacterales (SAR11), lacks the canonical GlnB, GlnD, GlnK, and...
- Full Text:
- PII-Independent Response to Nitrogen Limitation in a Free-Living Alphaproteobacterium Daniel P. Smith
-
- Creator:
- Villeneuve, Daniel, Volz, David C., Embry, Michelle R., Ankley, Gerald T., Belanger, Scott E., Léonard, Marc, Schirmer, Kristin, Tanguay, Robert, Truong, Lisa, and Wehmas, Leah
- Abstract:
- The fish early-life stage (FELS) test (Organisation for Economic Co-operation and Development [OECD] test guideline 210) is the primary test used internationally to estimate chronic fish toxicity in support of ecological risk assessments and chemical management programs. As part of an ongoing effort to develop efficient and cost-effective alternatives to...
- Full Text:
- ANNOTATING ADVERSE OUTCOME PATHWAYS FOR EARLY FISH DEVELOPMENT DANIEL VILLENEUVE,y DAVID C. VOLZ,z MICHELLE
-
- Creator:
- Villeneuve, Daniel, Volz, David C., Embry, Michelle R., Ankley, Gerald T., Belanger, Scott E., Léonard, Marc, Schirmer, Kristin, Tanguay, Robert, Truong, Lisa, and Wehmas, Leah
- Abstract:
- The fish early-life stage (FELS) test (Organisation for Economic Co-operation and Development [OECD] test guideline 210) is the primary test used internationally to estimate chronic fish toxicity in support of ecological risk assessments and chemical management programs. As part of an ongoing effort to develop efficient and cost-effective alternatives to...
-
- Creator:
- Cziczo, Daniel J., Froyd, Karl D., Hoose, Corinna, Jensen, Eric J., Diao, Minghui, Zondlo, Mark A., Smith, Jessica B., Twohy, Cynthia H., and Murphy, Daniel M.
- Abstract:
- Formation of cirrus clouds depends on the availability of ice nuclei to begin condensation of atmospheric water vapor. Although it is known that only a small fraction of atmospheric aerosols are efficient ice nuclei, the critical ingredients that make those aerosols so effective have not been established. We have determined...
- Full Text:
- . Hartogh et al., Nature 478, 218 (2011). 11. K. Lodders, R. Osborne, Space Sci. Rev. 90, 289 (1999). 12. R
-
- Creator:
- Cziczo, Daniel J., Froyd, Karl D., Hoose, Corinna, Jensen, Eric J., Diao, Minghui, Zondlo, Mark A., Smith, Jessica B., Twohy, Cynthia H., and Murphy, Daniel M.
- Abstract:
- Formation of cirrus clouds depends on the availability of ice nuclei to begin condensation of atmospheric water vapor. Although it is known that only a small fraction of atmospheric aerosols are efficient ice nuclei, the critical ingredients that make those aerosols so effective have not been established. We have determined...
- Full Text:
- the Dominant Sources and Mechanisms of Cirrus Cloud Formation Daniel J. Cziczo,* Karl D. Froyd
-
- Creator:
- Dore, John E., Church, Matthew J., Karl, David M., Sadler, Daniel W., and Letelier, Ricardo M.
- Abstract:
- Sustained time series have provided compelling evidence for progressive acidification of the surface oceans through exchange with the growing atmospheric reservoir of carbon dioxide. However, few long-term programs exist, and extrapolation of results from one site to larger oceanic expanses is hampered by the lack of spatial coverage inherent to...
- Full Text:
- ., Church, M. J., Karl, D. M., Sadler, D. W., & Letelier, R. M. (2014). Paired windward and leeward
-
- Creator:
- Orben, Rachael A., Paredes, Rosana, Roby, Daniel D., Irons, David B., and Shaffer, Scott A.
- Abstract:
- 1. Foraging and migration often require different energetic and movement strategies. Though not readily apparent, constraints during one phase might influence the foraging strategies observed in another. For marine birds that fly and dive, body size constraints likely present a trade-off between foraging ability and migration as smaller bodies reduce...
- Full Text:
- of thick-billed murres in the Bering Sea Orben, R. A., Paredes, R., Roby, D. D., Irons, D. B
-
- Creator:
- Schoebel, Corine N., Stewart, Jane, Gruenwald, Niklaus J., Rigling, Daniel, and Prospero, Simone
- Abstract:
- Human activity has been shown to considerably affect the spread of dangerous pests and pathogens worldwide. Therefore, strict regulations of international trade exist for particularly harmful pathogenic organisms. Phytophthora plurivora, which is not subject to regulations, is a plant pathogen frequently found on a broad range of host species, both...
- Full Text:
- Stewart2,3¤, Niklaus J. Gruenwald2,3, Daniel Rigling1, Simone Prospero1 1 Swiss Federal Institute for Forest
-
- Creator:
- Wiedemeier, Daniel B., Abiven, Samuel, Hockaday, William C., Keiluweit, Marco, Kleber, Markus, and et al.
- Abstract:
- The aromatic carbon structure is a defining property of chars and is often expressed with the help of two concepts: (i) aromaticity and (ii) degree of aromatic condensation. The varying extent of these two features is assumed to largely determine the relatively high persistence of charred material in the environment...
- Full Text:
- : daniel.wiedemeier@geo.uzh.ch (D.B. Wiedemeier). Daniel B. Wiedemeier a,⇑, Samuel Abiven a, William C. Hockaday b
-
- Creator:
- Wiedemeier, Daniel B., Abiven, Samuel, Hockaday, William C., Keiluweit, Marco, Kleber, Markus, and et al.
- Abstract:
- The aromatic carbon structure is a defining property of chars and is often expressed with the help of two concepts: (i) aromaticity and (ii) degree of aromatic condensation. The varying extent of these two features is assumed to largely determine the relatively high persistence of charred material in the environment...
- Full Text:
- - model molecules for graphite. Chemical Physics 196, 47-58. Baldock, J., Smernik, R., 2002. Chemical
-
- Creator:
- Kurnianto, Sofyan, Warren, Matthew, Talbot, Julie, Kauffman, Boone, Murdiyarso, Daniel, and Frolking, Steve
- Abstract:
- Tropical peatlands cover an estimated 440,000 km² (~10% of global peatland area) and are significant in the global carbon cycle by storing about 40–90 Gt C in peat. Over the past several decades, tropical peatlands have experienced high rates of deforestation and conversion, which is often associated with lowering the...
-
- Creator:
- Jacobson, Terry A., Maki, Kevin C., Orringer, Carl E., Jones, Peter H., Kris-Etherton, Penny, Sikand, Geeta, La Forge, Ralph, Daniels, Stephen R., Wilson, Don P., Morris, Pamela B., Wild, Robert A., Grundy, Scott M., Daviglus, Martha, Ferdinand, Keith C., Vijayaraghavan, Krishnaswami, Deedwania, Prakash C., Aberg, Judith A., Liao, Katherine P., McKenney, James M., Ross, Joyce L., Braun, Lynne T., Ito, Matthew K., Bays, Harold E., Brown, W. Virgil, Underberg, James A., and NLA Expert Panel
- Abstract:
- An Expert Panel convened by the National Lipid Association previously developed a consensus set of recommendations for the patient-centered management of dyslipidemia in clinical medicine (part 1). These were guided by the principle that reducing elevated levels of atherogenic cholesterol (non–high-density lipoprotein cholesterol and low-density lipoprotein cholesterol) reduces the risk...
- Full Text:
- , Ralph La Forge, MSc, Stephen R. Daniels, MD, PhD, Don P. Wilson, MD, Pamela B. Morris, MD, Robert A
-
- Creator:
- Li, Cong, Batistel, Fernanda, Osorio, Johan Samir, Drackley, James K., Luchini, Daniel, and Loor, Juan J.
- Abstract:
- Background: Main objectives were to determine to what extent Smartamine M (SM) supplementation to a prepartal higher-energy diet could alter neutrophil (PMN) and liver tissue immunometabolic biomarkers, and whether those responses were comparable to those in cows fed a prepartal lower-energy diet (CON). Results: Twenty-eight multiparous Holstein cows were fed...
- Full Text:
- Primers1 Primers (5’-3’) bp2 NM_001098007.1 GOLGA5 F.1370 R.1472 GAGCTACAGCAGCAAGTCAAAGTG
-
- Creator:
- Hostetter, Nathan J., Evans, Allen F., Cramer, Bradley M., Collis, Ken, Lyons, Donald E., and Roby, Daniel D.
- Abstract:
- Accurate assessment of specific mortality factors is vital to prioritize recovery actions for threatened and endangered species. For decades, tag recovery methods have been used to estimate fish mortality due to avian predation. Predation probabilities derived from fish tag recoveries on piscivorous waterbird colonies typically reflect minimum estimates of predation...
- Full Text:
- and Wildlife, Oregon State University, 104 Nash Hall, Corvallis, Oregon 97331, USA Daniel D. Roby
-
- Creator:
- Lee, Lewina O., Aldwin, Carolyn M., Kubzansky, Laura D., Chen, Edith, Mroczek, Daniel K., Wang, Joyce M., and Spiro, Avron III
- Abstract:
- Although early adversity has been linked to worse mental and physical health in adulthood, few studies have investigated the pathways through which positive and negative dimensions of early experiences can jointly influence psychological well-being in later life. This study examined: (a) profiles of early experiences across multiple domains, (b) the...
- Full Text:
- State University Laura D. Kubzansky Harvard School of Public Health Edith Chen and Daniel K. Mroczek
-
- Creator:
- Farnsworth, Andrew, Van Doren, Benjamin M., Hochachka, Wesley M., Sheldon, Daniel, Winner, Kevin, Irvine, Jed, Geevarghese, Jeffrey, and Kelling, Steve
- Abstract:
- Billions of birds migrate at night over North America each year. However, few studies have described the phenology of these movements, such as magnitudes, directions, and speeds, for more than one migration season and at regional scales. In this study, we characterize density, direction, and speed of nocturnally migrating birds...
- Full Text:
- m. hochAchkA,1 dAnIel sheldon,2,3 keVIn wInner,2 jed IrVIne,4 jeFFrey GeeVArGhese,2 And steVe
-
- Creator:
- Orben, Rachael A., Irons, David B., Paredes, Rosana, Roby, Daniel D., Phillips, Richard A., and Shaffer, Scott A.
- Abstract:
- AIM: Species that breed sympatrically often occupy different foraging niches to mitigate competition for prey. When resource availability declines at the end of the breeding season, some animals migrate to regions with more favourable environmental conditions. When these life-history traits combine, foraging habitat preferences may continue to influence migration patterns...
- Full Text:
- migrations Orben, R. A., Irons, D. B., Paredes, R., Roby, D. D., Phillips, R. A., & Shaffer, S. A. (2015
-
- Creator:
- Alexander, Alana, Steel, Debbie, Hoekzema, Kendra, Mesnick, Sarah L., Engelhaupt, Daniel, Kerr, Iain, Payne, Roger, and Baker, C. Scott
- Abstract:
- The interplay of natural selection and genetic drift, influenced by geographic isolation, mating systems and population size, determines patterns of genetic diversity within species. The sperm whale provides an interesting example of a long-lived species with few geographic barriers to dispersal. Worldwide mtDNA diversity is relatively low, but highly structured...
- Full Text:
- ,*† KENDRA HOEKZEMA,† SARAH L. MESNICK,§ DANIEL ENGELHAUPT,¶ IAIN KERR,** ROGER PAYNE** and C. SCOTT BAKER
-
- Creator:
- Pardo, Mario A., Gerrodette, Tim, Beier, Emilio, Gendron, Diane, Forney, Karin A., Chivers, Susan J., Barlow, Jay, and Palacios, Daniel M.
- Abstract:
- We inferred the population densities of blue whales (Balaenoptera musculus) and short-beaked common dolphins (Delphinus delphis) in the Northeast Pacific Ocean as functions of the water-column’s physical structure by implementing hierarchical models in a Bayesian framework. This approach allowed us to propagate the uncertainty of the field observations into the...
- Full Text:
- Beier2, Diane Gendron4, Karin A. Forney3, Susan J. Chivers3, Jay Barlow3, Daniel M. Palacios5 1 Posgrado
-
- Creator:
- Farnsworth, Andrew, Van Doren, Benjamin M., Hochachka, Wesley M., Sheldon, Daniel, Winner, Kevin, Irvine, Jed, Geevarghese, Jeffrey, and Kelling, Steve
- Abstract:
- Billions of birds migrate at night over North America each year. However, few studies have described the phenology of these movements, such as magnitudes, directions, and speeds, for more than one migration season and at regional scales. In this study, we characterize density, direction, and speed of nocturnally migrating birds...
- Full Text:
- targets Andrew Farnsworth1, Benjamin M. Van Doren1, Wesley M. Hochachka1, Daniel Sheldon2,3, Kevin
-
- Creator:
- Kile, Molly L., Coker, Eric S., Smit, Ellen, Sudakin, Daniel, Molitor, John, and Harding, Anna K.
- Abstract:
- BACKGROUND: Gas stoves emit pollutants that are respiratory irritants. U.S. children under age 6 who live in homes where gas stoves are used for cooking or heating have an increased risk of asthma, wheeze and reduced lung function. Yet few studies have examined whether using ventilation when operating gas stoves...
- Full Text:
- NHANESIII Molly L Kile1*, Eric S Coker1, Ellen Smit1, Daniel Sudakin2, John Molitor1 and Anna K Harding1
-
- Creator:
- Chudnov, Daniel, Binkley, Peter, Frumkin, Jeremy, Giarlo, Michael, Rylander, Mike, Singer, Ross, and Summers, Ed
- Abstract:
- Several of us describe unAPI, a tiny HTTP API for serving information objects in next-generation web applications.
- Full Text:
- /vanveen/ 2. Chudnov, D., Frumkin, J., Weintraub, J., Wilcox, M., Yee, R., "Towards Library Groupware with
-
- Creator:
- Alexander, Alana, Steel, Debbie, Hoekzema, Kendra, Mesnick, Sarah L., Engelhaupt, Daniel, Kerr, Iain, Payne, Roger, and Baker, C. Scott
- Abstract:
- The interplay of natural selection and genetic drift, influenced by geographic isolation, mating systems and population size, determines patterns of genetic diversity within species. The sperm whale provides an interesting example of a long-lived species with few geographic barriers to dispersal. Worldwide mtDNA diversity is relatively low, but highly structured...
- Full Text:
- Alexander1,2,3*, Debbie Steel1,2, Kendra Hoekzema2, Sarah Mesnick4, Daniel Engelhaupt5, Iain Kerr6, Roger Payne6
-
- Creator:
- Mora, Camilo, Wei, Chih-Lin, Rollo, Audrey, Amaro, Teresa, Baco, Amy R., Billett, David, Bopp, Laurent, Chen, Qi, Collier, Mark, Danovaro, Roberto, Gooday, Andrew J., Grupe, Benjamin M., Halloran, Paul R., Ingels, Jeroen, Jones, Daniel O. B., Levin, Lisa A., Nakano, Hideyuki, Norling, Karl, Ramirez-Llodra, Eva, Rex, Michael, Ruhl, Henry A., Smith, Craig R., Sweetman, Andrew K., Thurber, Andrew R., Tjiputra, Jerry F., Usseglio, Paolo, Watling, Les, Wu, Tongwen, and Yasuhara, Moriaki
- Abstract:
- Ongoing greenhouse gas emissions can modify climate processes and induce shifts in ocean temperature, pH, oxygen concentration, and productivity, which in turn could alter biological and social systems. Here, we provide a synoptic global assessment of the simultaneous changes in future ocean biogeochemical variables over marine biota and their broader...
- Full Text:
- Mora1*, Chih-Lin Wei2, Audrey Rollo3, Teresa Amaro4, Amy R. Baco5, David Billett6, Laurent Bopp7, Qi
-
- Creator:
- Mora, Camilo, Wei, Chih-Lin, Rollo, Audrey, Amaro, Teresa, Baco, Amy R., Billett, David, Bopp, Laurent, Chen, Qi, Collier, Mark, Danovaro, Roberto, Gooday, Andrew J., Grupe, Benjamin M., Halloran, Paul R., Ingels, Jeroen, Jones, Daniel O. B., Levin, Lisa A., Nakano, Hideyuki, Norling, Karl, Ramirez-Llodra, Eva, Rex, Michael, Ruhl, Henry A., Smith, Craig R., Sweetman, Andrew K., Thurber, Andrew R., Tjiputra, Jerry F., Usseglio, Paolo, Watling, Les, Wu, Tongwen, and Yasuhara, Moriaki
- Abstract:
- Ongoing greenhouse gas emissions can modify climate processes and induce shifts in ocean temperature, pH, oxygen concentration, and productivity, which in turn could alter biological and social systems. Here, we provide a synoptic global assessment of the simultaneous changes in future ocean biogeochemical variables over marine biota and their broader...
-
- Creator:
- Varol, H. Samet, Sanchez, M. Alejandra, Lu, Hao, Baio, Joe E., Malm, Christian, Encinas, Noemi, Mermet-Guyennet, Marius R. B., Martzel, Nicolas, Bonn, Daniel, Bonn, Mischa, Weidner, Tobias, Backus, Ellen H. G., and Parekh, Sapun H.
- Abstract:
- Dispersing hydrophilic nanofillers in highly hydrophobic polymer matrices is widely used to tune the mechanical properties of composite material systems. The ability to control the dispersion of fillers is closely related to the mechanical tunability of such composites. In this work, we investigate the physical–chemical underpinnings of how simple end-group...
- Full Text:
- Encinas c, Marius R. B. Mermet-Guyennet d, Nicolas Martzel e, Daniel Bonn d, Mischa Bonn a, Tobias
-
- Creator:
- Varol, H. Samet, Sanchez, M. Alejandra, Lu, Hao, Baio, Joe E., Malm, Christian, Encinas, Noemi, Mermet-Guyennet, Marius R. B., Martzel, Nicolas, Bonn, Daniel, Bonn, Mischa, Weidner, Tobias, Backus, Ellen H. G., and Parekh, Sapun H.
- Abstract:
- Dispersing hydrophilic nanofillers in highly hydrophobic polymer matrices is widely used to tune the mechanical properties of composite material systems. The ability to control the dispersion of fillers is closely related to the mechanical tunability of such composites. In this work, we investigate the physical–chemical underpinnings of how simple end-group...
- Full Text:
- b, Christian Malm a, Noemi Encinas c, 3 Marius R. B. Mermet–Guyennet d, Nicolas Martzel e, Daniel
-
- Creator:
- Li, Cong, Batistel, Fernanda, Osorio, Johan Samir, Drackley, James K., Luchini, Daniel, and Loor, Juan J.
- Abstract:
- Background: Main objectives were to determine to what extent Smartamine M (SM) supplementation to a prepartal higher-energy diet could alter neutrophil (PMN) and liver tissue immunometabolic biomarkers, and whether those responses were comparable to those in cows fed a prepartal lower-energy diet (CON). Results: Twenty-eight multiparous Holstein cows were fed...
- Full Text:
- , Johan Samir Osorio3, James K. Drackley2, Daniel Luchini4 and Juan J. Loor2* Abstract Background: Main
-
- Creator:
- Holmes, Mollie E.
- Abstract:
- In contemporary art, some artists enter into working relationships with other groups or institutions to create a final piece. For example, an artist may be invited by a museum to take part in an exhibition, or an artist may work with a city council to create a public artwork. However,...
- Full Text:
- of the different working relationships of contemporary artists such as Daniel Buren, Fred Wilson
-
- Creator:
- Richmond, Henry R. and American Land Institute (Portland, Oregon)
- Abstract:
- This is a response prepared by Henry R. Richmond of the American Land Institute to the SB 82/"Big Look" Task Force report, "Big Look: Choices for the future" (issued, May 30, 2008). It appear was written on July 11, 2008 and consists of three files: comments, updated cover page for...
- Full Text:
- , 2008 to Oregon Task Force on Land Use Planning from American Land Institute Henry R. Richmond
-
- Creator:
- Sigl, Michael, Fudge, Tyler J., Winstrup, Mai, Cole-Dai, Jihong, Ferris, David, McConnell, Joseph R., Taylor, Ken C., Welten, Kees C., Woodruff, Thomas E., Adolphi, Florian, Bisiaux, Marion, Brook, Edward J., Buizert, Christo, Caffee, Marc W., Dunbar, Nelia W., Edwards, Ross, Geng, Lei, Iverson, Nels, Koffman, Bess, Layman, Lawrence, Maselli, Olivia J., McGwire, Kenneth, Muscheler, Raimund, Nishiizumi, Kunihiko, Pasteris, Daniel R., Rhodes, Rachael H., and Sowers, Todd A
- Abstract:
- We present the WD2014 chronology for the upper part (0–2850 m; 31.2 ka BP) of the West Antarctic Ice Sheet (WAIS) Divide (WD) ice core. The chronology is based on counting of annual layers observed in the chemical, dust and electrical conductivity records. These layers are caused by seasonal changes...
- Full Text:
- , Lawrence Layman1, Olivia J. Maselli1, Kenneth McGwire1, Raimund Muscheler8, Kunihiko Nishiizumi6, Daniel R
-
- Creator:
- Sigl, Michael, Fudge, Tyler J., Winstrup, Mai, Cole-Dai, Jihong, Ferris, David, McConnell, Joseph R., Taylor, Ken C., Welten, Kees C., Woodruff, Thomas E., Adolphi, Florian, Bisiaux, Marion, Brook, Edward J., Buizert, Christo, Caffee, Marc W., Dunbar, Nelia W., Edwards, Ross, Geng, Lei, Iverson, Nels, Koffman, Bess, Layman, Lawrence, Maselli, Olivia J., McGwire, Kenneth, Muscheler, Raimund, Nishiizumi, Kunihiko, Pasteris, Daniel R., Rhodes, Rachael H., and Sowers, Todd A
- Abstract:
- We present the WD2014 chronology for the upper part (0–2850 m; 31.2 ka BP) of the West Antarctic Ice Sheet (WAIS) Divide (WD) ice core. The chronology is based on counting of annual layers observed in the chemical, dust and electrical conductivity records. These layers are caused by seasonal changes...
- Full Text:
- ., Spahni, R., Capron, E., Chappellaz, J., Leuenberger, M., Fischer, H., and Stocker, T. F.: NGRIP CH4
-
- Creator:
- Wilson, Heather, Ripp, Sophie, Prisbrey, Landon, Brown, Morgan A., Sharf, Tal, Myles, Daniel J. T., Blank, Kerstin G., and Minot, Ethan D.
- Abstract:
- Many carbon nanotube (CNT) applications require precisely controlled chemical functionalization that is minimally disruptive to electrical performance. A promising approach is the generation of sp³ hybridized carbon atoms in the sp²-bonded lattice. We have investigated the possibility of using a carboxylic acid functionalized diazonium reagent to introduce a defined number...
- Full Text:
- . Brown1, Tal Sharf1, Daniel J. T. Myles3, Kerstin G. Blank2, Ethan D. Minot1 1Department of Physics
-
- Creator:
- Evans, Allen F., Payton, Quinn, Turecek, Aaron, Cramer, Bradley, Collis, Ken, Roby, Daniel D., Loschl, Peter J., Sullivan, Leah, Skalski, John, Weiland, Mark, and Dotson, Curtis
- Abstract:
- We evaluated the impact of predation on juvenile steelhead Oncorhynchus mykiss and yearling and subyearling Chinook Salmon O. tshawytscha by piscivorous waterbirds from 11 different breeding colonies in the Columbia River basin during 2012 and 2014. Fish were tagged with both acoustic tags and PIT tags and were tracked via...
- Full Text:
- Daniel D. Roby U.S. Geological Survey, Oregon Cooperative Fish and Wildlife Research Unit, Department of
- « Previous
- Next »
- 1
- 2
- 3
- 4