The end of the Cold War brought about changes within international political relations that resulted in expanded interest in global civil society. Such developments, like globalization and democratization, have encouraged the growth of social and political organizations. Political scientists have found that these inter-governmental and non-governmental organizations have a significant...
Full Text:
-apartheid campaign in South Africa, among many others. More recently, U2's lead singer, Bono, has branched
Eukaryotic ribosome biogenesis involves ~200 assembly
factors, but how these contribute to ribosome
maturation is poorly understood. Here, we
identify a network of factors on the nascent 60S subunit
that actively remodels preribosome structure. At its hub is
Rsa4, a direct substrate of the force-generating ATPase
Rea1. We show that...
Full Text:
analysis, S. Granneman did the CRAC experiment, and S. Granneman and D. Tollervey
analyzed data. J. Baßler
Recalcitrance to transformation makes genetic engineering of many valuable plants infeasible for practical use. Transitory host modification during transformation using transgenes offers a possible means of overcoming this obstacle. In prior work in our laboratory, the genes GA20ox7 and EBB1 were found to increase regeneration in vitro. In this project,...
Full Text:
propagated
Genome and gene expression sequences
EBB1’s discovery and observations
EBB1 discovered using
The field performance of genetic containment technologies–considered important for
certain uses of transgenic trees in forestry–are poorly known. We tested the efficiency of a
barnase gene driven by the TA29 tapetum-dominant promoter for influencing growth rate and
inducing male-sterility in a field trial of transgenic hybrid poplar (Populus tremula x...
Full Text:
. i and j, transgenic event 7. The black bar in the catkin image i corresponds to 1 cm and
the
The field performance of genetic containment technologies–considered important for
certain uses of transgenic trees in forestry–are poorly known. We tested the efficiency of a
barnase gene driven by the TA29 tapetum-dominant promoter for influencing growth rate and
inducing male-sterility in a field trial of transgenic hybrid poplar (Populus tremula x...
Full Text:
male sterility and slows
field growth in Populus
Elorriaga, E., Meilan, R., Ma, C., Skinner, J. S
Recalcitrance to transformation makes genetic engineering of many valuable plants infeasible for practical use. Transitory host modification during transformation using transgenes offers a possible means of overcoming this obstacle. In prior work in our laboratory, the genes GA20ox7 and EBB1 were found to increase regeneration in vitro. In this project,...
Full Text:
, S., & ... Friml, J. (2011). PIN
Polarity Maintenance by the Cell Wall in Arabidopsis. Current
The stability and value of transgenic pest resistance for promoting tree growth are poorly understood. These data are
essential for determining if such trees could be beneficial to commercial growers in the face of substantial regulatory and
marketing costs. We investigated growth and insect resistance in hybrid poplar expressing the...
Full Text:
, Jeffrey S. Skinner, Brenda Oppert, Guy A. Cardineau, and Steven H. Strauss
Abstract: The stability and
The field performance of genetic containment technologies–considered important for
certain uses of transgenic trees in forestry–are poorly known. We tested the efficiency of a
barnase gene driven by the TA29 tapetum-dominant promoter for influencing growth rate and
inducing male-sterility in a field trial of transgenic hybrid poplar (Populus tremula x...
Full Text:
aggactattctggcttcctcttac
ccagactgaatgcccacaggcc
880 Detection of
GUS gene
Skinner et
al. (2003
The field performance of genetic containment technologies–considered important for
certain uses of transgenic trees in forestry–are poorly known. We tested the efficiency of a
barnase gene driven by the TA29 tapetum-dominant promoter for influencing growth rate and
inducing male-sterility in a field trial of transgenic hybrid poplar (Populus tremula x...
The study related the density of herbivores to the length and density of Prionitis spp. in Oregon’s coastal tidepools. Oregon’s coastal rocky intertidal tidepools contain a variety of species interactions, including algal grazing by herbivores. The red branched algae Prionitis spp. is found throughout the rocky intertidal in the low...