Index Catalog // ScholarsArchive@OSU

What Makes a Fish Resistant? Comparative Genomics and Transcriptomics of Oncorhynchus mykiss with Differential Resistance to the Parasite Ceratonova shasta

Creator:: Barrett, Damien E.
Abstract:: The myxozoan Ceratonova shasta is an intestinal parasite of salmon and trout that causes ceratomyxosis, a disease characterized by severe inflammation of the intestine that can lead to hemorrhaging, necrosis, and death of the fish host. The parasite is endemic to the Pacific Northwest of the United States and Canada,...
Resource Type:: Dissertation
Full Text:: supplying the fish used in these studies. My graduate committee members; Dr. Michael Kent, Dr. Kelly

The Role of the Mucosal Immunoglobulin IgT and Inflammatory Cytokines in Ceratonova shasta Infections in Rainbow Trout

Creator:: Taggart-Murphy, Laura M.
Abstract:: The myxozoan parasite Ceratonova shasta threatens both juvenile and adult salmonid populations in the Pacific Northwest region of the United States, causing intestine necrosis and hemorrhaging, along with high mortality in some fish strains. It induces an inflammatory tissue response in susceptible strains of fish; understanding the interactions between C....
Resource Type:: Masters Thesis
Full Text:: with data analysis and interpretation, and Dr. J. Oriol Sunyer provided financial support. For the

The introduction of myxozoan parasites through the release of feeder goldfish (Carassius auratus)

Creator:: Karandashova, Sophia
Abstract:: Myxozoa have been found worldwide; these parasites infect a wide variety of hosts, but have been found most often in fish. Carassius auratus (goldfish), a popular aquarium fish and a widespread invasive species, have been identified as an intermediate host for several myxozoan species. Some myxozoan parasites are pathogenic and...
Resource Type:: Honors College Thesis
Full Text:: life cycle and development of the Myxozoa, exemplified by Myxobolus sp. (from Kent

The effects of single and multiple pathogen and parasite infections on juvenile chinook and coho salmon during early marine residency

Creator:: Sandell, Todd A.
Abstract:: Nearly 3000 juvenile Chinook (Oncorhynchus tshawytscha) and coho (O. kisutch) salmon captured in nearshore waters off the coasts of Washington and Oregon from 1999-2004 were tested for infection by Renibacterium salmoninarum, Nanophyetus salmincola, and skin metacercariae. First, three quantitative PCR primer/probe sets were compared for detection of R. salmoninarum; amplification...
Resource Type:: Dissertation
Full Text:: exposed to high densities of the bacterium near salmon net pens (Kent et al. 1998). Although R

The ecology of parasite interactions within Chinook salmon

Creator:: Hurst, Charlene N.
Abstract:: The within-host interactions that can occur as a result of mixed infections in wildlife likely influence the outcome of an infection. We investigated the infection frequency and outcome as well as the potential mechanisms regulating mixed infections with two Ceratonova shasta genotypes within the Chinook salmon host. Previous research in...
Resource Type:: Dissertation
Full Text:: , Peter Wong, Sascha L. Hallett, R. Adam Ray and Jerri L. Bartholomew

Supplemental Description of Myxobolus squamalis (Myxozoa) & Epidemiology of M. squamalis at Two Oregon Hatcheries

Creator:: Polley, Tamsen M.
Abstract:: Myxobolus squamalis is a Myxozoan parasite of salmonids, which contributes to lowered fitness of hatchery and wild fish in the Pacific Northwest of North America. The only GenBank DNA sequence of M. squamalis is from Oncorhynchus tschawytscha (Chinook), but is not linked to a published morphological description. There is a...
Resource Type:: Honors College Thesis
Full Text:: GTGCCTTGAATAAATCAGAG Kent et al. 2000 ERIB10 R CTTCCGCAGGTTCACCTACGG Barta et al. 1997 MS193 F CCAACTACCGGCGTAACG

Risk assessment : introduction and establishment of Myxobolus cerebralis in the Deschutes River Basin, Oregon, USA

Creator:: Zielinski, Christopher
Abstract:: A plan for the reestablishment of anadromous salmonid stocks into waters above the Pelton Round Butte Hydroelectric Project (PRB) located on the Deschutes River, Oregon has been under development since 1996. The PRB complex, starting at river kilometer (Rkm) 103, blocks the further upstream migration of anadromous salmonids into upper...
Resource Type:: Masters Thesis

Re-examining Ceratomyxa shasta in the Pacific Northwest

Creator:: Stinson, Matthew E. T.
Abstract:: Ceratomyxa shasta infects salmonids in the Pacific Northwest (PNW) of North America, occasionally causing losses in wild and captive populations. Host-specific parasite genotypes (O, I, II, III) were previously characterized molecularly using markers in the ribosomal DNA and phenotypically by type host in the Klamath River, CA/OR. This thesis sough...
Resource Type:: Masters Thesis
Full Text:: Evolution 10: 1019–1026. Atkinson, S. D., S. R. M. Jones, R. D. Adlard, and J. L. Bartholomew. 2011

Potential for dispersal of the non-native parasite Myxobolus cerebralis : qualitative risk assessments for the state of Alaska and the Willamette River Basin, Oregon

Creator:: Arsan, E. Leyla
Abstract:: First introduced to the USA in 1958, Myxobolus cerebralis, the parasite responsible for whirling disease in salmonids, has since spread across the country causing severe declines in wild trout populations in the intermountain west. Recent development of risk assessment models used to assess the likelihood and consequences of exotic parasite...
Resource Type:: Masters Thesis
Full Text:: bases: R=A+G, K=T+G, Y=C+T.……………………………………………………………… 75 4.1 Definitions of probability levels used

Mortality threshold for juvenile Chinook salmon (Oncorhynchus tshawytscha) in an epidemiological model of Ceratomyxa shasta

Creator:: Ray, R. Adam
Abstract:: The myxozoan parasite, Ceratomyxa shasta, is the most significant pathogen of juvenile Chinook salmon (Oncorhynchus tshawytscha) in the Klamath River, CA, USA. This parasite requires two hosts - a freshwater polychaete (Manayunkia speciosa) and a salmonid - to complete its life cycle. The complex life cycle and large geographic area...
Resource Type:: Masters Thesis
Full Text:: THESIS OF R. Adam Ray for the degree of Master of Science in Fisheries Science presented on November

ScholarsArchive@OSU

What Makes a Fish Resistant? Comparative Genomics and Transcriptomics of Oncorhynchus mykiss with Differential Resistance to the Parasite Ceratonova shasta

The Role of the Mucosal Immunoglobulin IgT and Inflammatory Cytokines in Ceratonova shasta Infections in Rainbow Trout

The introduction of myxozoan parasites through the release of feeder goldfish (Carassius auratus)

The effects of single and multiple pathogen and parasite infections on juvenile chinook and coho salmon during early marine residency

The ecology of parasite interactions within Chinook salmon

Supplemental Description of Myxobolus squamalis (Myxozoa) & Epidemiology of M. squamalis at Two Oregon Hatcheries

Risk assessment : introduction and establishment of Myxobolus cerebralis in the Deschutes River Basin, Oregon, USA

Re-examining Ceratomyxa shasta in the Pacific Northwest

Potential for dispersal of the non-native parasite Myxobolus cerebralis : qualitative risk assessments for the state of Alaska and the Willamette River Basin, Oregon

Mortality threshold for juvenile Chinook salmon (Oncorhynchus tshawytscha) in an epidemiological model of Ceratomyxa shasta

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search