Index Catalog // ScholarsArchive@OSU

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

Creator:: Bernier, Jeremiah C.
Abstract:: Chinook salmon (Oncorhynchus tshawytscha) display the greatest variability of return times to freshwater of all Pacific salmon. Differential return times to freshwater have segregated populations of Chinook into two broad types or runs, fall and spring, named for the time of year in which they migrate to freshwater. Migration time...
Resource Type:: Masters Thesis
Full Text:: cytochrome c oxidase subunit III 18681 CATGACTTAGCAAGAAATGGA 0 0 18 9.09 n/a uniquely present QM (ribosomal

The effects of single and multiple pathogen and parasite infections on juvenile chinook and coho salmon during early marine residency

Creator:: Sandell, Todd A.
Abstract:: Nearly 3000 juvenile Chinook (Oncorhynchus tshawytscha) and coho (O. kisutch) salmon captured in nearshore waters off the coasts of Washington and Oregon from 1999-2004 were tested for infection by Renibacterium salmoninarum, Nanophyetus salmincola, and skin metacercariae. First, three quantitative PCR primer/probe sets were compared for detection of R. salmoninarum; amplification...
Resource Type:: Dissertation
Full Text:: THE DISSERTATION OF Todd A. Sandell for the degree of Doctor of Philosophy in Microbiology

Impacts of multispecies parasitism on coho salmon (Oncorhynchus kisutch) in Oregon

Creator:: Ferguson, Jayde A.
Abstract:: Diseases caused by parasites are recognized as significant sources of mortality in wild fish populations. I assessed the impacts of multispecies parasitism on a threatened stock of juvenile coho salmon (Oncorhynchus kisutch). A crucial prerequisite to this research was proper identification of parasites, which can be difficult for species lacking...
Resource Type:: Dissertation
Full Text:: ABSTRACT OF THE DISSERTATION OF Jayde A. Ferguson for the degree of Doctor of Philosophy in

The importance of egg size for the diversity of salmonids

Creator:: Leblanc, Camille A.
Abstract:: Understanding the origin and nature of intra specific biodiversity enables us to better conserve and manage animal populations. Biological diversity is seen at different scales and for different traits such as behavior, morphology, physiology, and life history. Behavior is especially important since behavioral changes are believed to precede changes in...
Resource Type:: Dissertation
Full Text:: , and Carl Schreck for their helpful suggestions and guidance throughout my time as a PhD student

Potential for dispersal of the non-native parasite Myxobolus cerebralis : qualitative risk assessments for the state of Alaska and the Willamette River Basin, Oregon

Creator:: Arsan, E. Leyla
Abstract:: First introduced to the USA in 1958, Myxobolus cerebralis, the parasite responsible for whirling disease in salmonids, has since spread across the country causing severe declines in wild trout populations in the intermountain west. Recent development of risk assessment models used to assess the likelihood and consequences of exotic parasite...
Resource Type:: Masters Thesis
Full Text:: …………………….. 53 2.4b Comparative triactinomyxon release from Alaskan Tubifex tubifex groups A, B, and C

Experiments on the Hydraulics and Swimming Responses of Juvenile Chinook Salmon Encountering a Floating Guidance Structure

Creator:: Swanson, Samuel T.
Abstract:: Floating guidance structures are intended to promote safe in-stream passage for juvenile salmon migrating downstream through reservoirs. However, the ability of an engineered structure to guide fish to safe passage has been primarily tested either after large-scale implementation in existing reservoirs or in laboratory studies and computer simulations without live...
Resource Type:: Masters Thesis
Full Text:: guide wall (x = -0.5 to x = 0.5; Figure 5, A-C). Similarly, low magnitudes of TKE, TKE and velocity

Characteristics of pools used by adult summer steelhead (Oncorhynchus mykiss) in the Steamboat Creek Basin, North Umpqua River, Oregon

Creator:: Baigun, Claudio Rafael Mariano
Abstract:: This study examined features of deep pool (>0.8 m mean depth) used by adult summer steelhead in Steamboat Creek (1991-1992). Steamboat Creek had a heterogenous thermal profile, with some segments exceeding preferred temperature of steelhead. Deep pools were scarce (4% of the total habitat units) and 39% of them were...
Resource Type:: Masters Thesis
Full Text:: al. 1983). c) Bottom oxygen, defined as oxygen level at the bottom of the deepest point in a pool

Effects of diet on growth and development of nesting seabirds

Creator:: Romano, Marc D.
Abstract:: Recent declines in nesting success of some fish-eating seabirds in Alaska have been attributed to declines in availability of certain schooling forage fishes (e.g., capelin Mallotus villosus, Pacific sand lance Ammodytes hexapterus, and Pacific herring Clupea harengus pallasi). These fishes tend to have high lipid content compared with other species...
Resource Type:: Masters Thesis
Full Text:: Kittiwakes (A) and Tufted Puffins (B & C) raised on diets of high-lipid fishes (herring, sand lance, and

Interactions between the immune system, stress and thymulin

Creator:: Christian, Richard L., (Richard Leroy), 1971-
Abstract:: This study was conducted to determine the effects of shipping stress on the immune system in domestic lambs (Ovis aries) and to determine the potential of the thymic peptide, thymulin, to reduce those effects of stress on the immune system. Treatments consisted of no shipping (as unstressed controls), shipping (as...
Resource Type:: Masters Thesis
Full Text:: response to a standard antigen dose over a three week period following the stress was examined. Third

Biochemical and behavioral characterization of steroid receptors in neuronal membranes

Creator:: Orchinik, Miles
Resource Type:: Dissertation
Full Text:: °C.3 Specific binding was also inhibited in a concentration-dependent manner by treatment of the

ScholarsArchive@OSU

Neural gene expression profiling in chinook salmon (Oncorhynchus tshawytscha) of alternate run times

The effects of single and multiple pathogen and parasite infections on juvenile chinook and coho salmon during early marine residency

Impacts of multispecies parasitism on coho salmon (Oncorhynchus kisutch) in Oregon

The importance of egg size for the diversity of salmonids

Potential for dispersal of the non-native parasite Myxobolus cerebralis : qualitative risk assessments for the state of Alaska and the Willamette River Basin, Oregon

Experiments on the Hydraulics and Swimming Responses of Juvenile Chinook Salmon Encountering a Floating Guidance Structure

Characteristics of pools used by adult summer steelhead (Oncorhynchus mykiss) in the Steamboat Creek Basin, North Umpqua River, Oregon

Effects of diet on growth and development of nesting seabirds

Interactions between the immune system, stress and thymulin

Biochemical and behavioral characterization of steroid receptors in neuronal membranes

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

File Format

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search