Index Catalog // ScholarsArchive@OSU

“SeW: A Search for Selenosulfide Bonding” and “Severity of Damage Inflicted on Intercellular Disulfide Bonds as a Result of UV Radiation”

Creator:: Dutcher, Kendall
Abstract:: Part 1: White muscle disease (WMD), a degenerative muscle disease brought on by a deficiency of the essential trace nutrient selenium, is thought to be mediated by the protein Selenoprotein W (SeW). In its relationship with WMD, SeW, like many selenoproteins, binds to glutathione, serving some purpose in redox mechanisms...
Resource Type:: Undergraduate Thesis and Research Paper

The application of geographic information systems for delineation and classification of tidal wetlands for resource management of Oregon’s coastal watersheds

Creator:: Scranton, Russell W.
Abstract:: Resource managers of Oregon’s tidal wetlands require an improved GIS layer for management of existing tidal wetland habitat and areas considered for tidal wetland restoration. A reconnaissance project was initiated, such that interpretations of remote sensing data, the National Wetland Inventory, Oregon Estuary Plan Book and additional management tools were...
Resource Type:: Capstone Project
Full Text:: annually by 2005(DSL 2002). Also on April 22nd 2004, Earth Day, the George W. Bush administration adopted

Generation of proof of concept molecules neutralizing monoclonal antibodies to IL17Cm

Creator:: Calhoun, Drew W.
Abstract:: Inflammation is one of the first, most important responses of the immune system when presented with infection and is mediated primarily by eicosanoids and cytokines. The goal of this research was to generate monoclonal antibodies against murine IL17C, a poorly characterized cytokine involved in inflammation and linked to inflammatory conditions....
Resource Type:: Honors College Thesis
Full Text:: THESIS OF Drew W. Calhoun for the degree of Honors Baccalaureate of Science in Biochemistry and

Vox comm: product development and program management

Creator:: Braunworth, Daniel W.
Abstract:: Vox comm is a digital wireless, voice-operated personal communicator developed as an electrical engineering Senior Design project. It is designed to provide a method for hassle-free, short-range communication. The product platform boasts of low power and small size for a host of usage models. This thesis details the product design...
Resource Type:: Honors College Thesis
Full Text:: THESIS OF Daniel W. Braunworth for the degree of Honors Baccalaureate of Science in Electrical and

Integration of submersible transect data andhigh-resolution sonar imagery for a habitat-based groundfish assessment of Heceta Bank, Oregon

Creator:: Nasby, Nicole M.
Abstract:: Dramatic declines in several groundfish populations have occurred along the U.S. West Coast during the last decade (PFMC 1999, Sampson 1997, Ralston 1998, Bloeser 1999). One problem exacerbating these declines is insufficient stock assessments, especially for species of west coast rockfish (Family Scorpaenidae, Genus Sebastes) which comprise the core of...
Resource Type:: Capstone Project
Full Text:: Kimerling, Member Robert W. Embley, Member Mark A. Hixon, Member 3 Master of Science

The face of Oregon's library community

Creator:: Webster, Janet G. and Cole, Maureen
Abstract:: One goal of the Oregon Library Association's Vision 2010 is to promote a strong and diverse workforce throughout all of the state's libraries. The forecasted shortage of librarians in the next decade prompted the OLA Board to request a demographic study of Oregon's libraries. A simple survey was adminstered at...
Resource Type:: Article
Full Text:: 1 1 1 F 26 G 15 1 1 1 1 H 31

The role of CYP2E1 and CYP4A in the development of non-alcoholic steatohepatitis

Creator:: Hawkins, Jenna M.
Abstract:: Non-alcoholic Steatohepatitis (NASH) is an emerging form of liver disease associated with obesity, type II diabetes and dyslipidemia. As the prevalence of these metabolic conditions increases, so too has the occurrence of NASH in all sectors of the population. The pathology of this disease is similar to its alcoholic form,...
Resource Type:: Honors College Thesis
Full Text:: Genotype Gender Age Metabolic State WT F 10 weeks lean WT M 9 weeks lean CamK-cre M 10 weeks lean

Discovery and identification of antibacterial agents for dental use

Creator:: Kirkpatrick, Adam G.
Abstract:: Dental disease is a very prevalent and costly disease in which the symptoms, not the disease, are currently being treated. The disease is caused by pathogenic oral bacteria, many of which are a part of the Mutans Streptococci. The objective of this thesis was to find a natural substance that...
Resource Type:: Honors College Thesis
Full Text:: Mutans Streptococci Species Serotype Host S. mutans c, e, f Human S. sobrinus d, g Human

Studies on a transgenic approach to decrease gliadin content in wheat

Creator:: Bell, Shannon M.
Abstract:: Celiac disease, an autoimmune response triggered by the consumption of seed storage proteins of cereals, affects an estimated 1% of the human population. In the case of wheat (Triticum aestivum L.), one of the world’s most consumed cereals, alcohol-soluble proteins, the gliadins, have been identified as the allergy-eliciting agents. Previous...
Resource Type:: Undergraduate Thesis
Full Text:: using a variety of PCR primers (Fig. 10). Primers RI_ANTI F (5’ CAAATTCTAATCCCCAATCCAA 3’) and RI_ANTI R

Effects of caustic addition on black liquor rheology and thermal characteristics

Creator:: Euhus, Daniel D.
Abstract:: An important by-product of the kraft pulping process, black liquor is currently used in most pulp mills to produce steam in a recovery boiler. Two important black liquor characteristics are viscosity and burning (firing) characteristics, which determine the operating efficiency of the recovery boiler. Kraft black liquor is a complicated...
Resource Type:: Honors College Thesis
Full Text:: homogeneity of the sample. -1.5 -1.0 -0.5 0.0 0.5 1.0 H ea t F lo w (W /g ) 0 20 40 60 80

Experiments into plasma physics

Creator:: Smith, Christopher S.
Abstract:: Our research was focused mainly on the field of plasma physics and the creation of plasmas in a laboratory environment. We first began our project with the goal to develop a tabletop Tokamak, a doughnut shaped device that magnetically confines plasmas at pressures greater than one atmosphere. After researching this...
Resource Type:: Honors College Thesis
Full Text:: Frequency Data Both Tubes f (kHz) V primary (V) Vsupply (V) I supply (A) P supply (W) 63.3

Expression of prolactin in feline mammary adenomas and adenocarcinomas

Creator:: Trummel, Danielle K.
Abstract:: Mammary tumors are the third most common tumor in cats after cutaneous neoplasia and lymphosarcoma. More than 80% of feline mammary tumors are adenocarcinomas, which are similar to human mammary adenocarcinomas in their biologic behavior and histologic characteristics. Despite treatment with radical mastectomy, feline mammary adenocarcinoma is associated with a...
Resource Type:: Undergraduate Thesis and Presentation
Full Text:: specificity of immunostaining was verified using a Universal negative antibody (B, F). Positive cytokeratin

Distribution and origin of organic matter preserved in modern surface sediments throughout Coastal SE Alaska

Creator:: Walinsky, Sarah E.
Abstract:: Twenty seven modern (top 1-2cm) sediment samples from multicores retrieved from throughout coastal SE Alaska were analyzed for their organic matter content and the source composition. Total organic carbon (TOC) as well as biogenic silica (bioSi), and calcium carbonate (CaCO3) content were analyzed to evaluate the organic matter content and...
Resource Type:: Honors College Thesis
Full Text:: samples further out on the continental shelf. The other samples east of 140°W are all tucked in the

Pathogenic Mechanisms of Cancer Causing hMLH1 Mutations

Creator:: O'Donnell, Edmond Francis
Abstract:: DNA mismatch repair (MMR) is an evolutionary conserved process that functions to maintain genomic integrity through the correction of mismatches that have escaped proofreading. Mutations in the MMR gene Mlh1 are associated with approximately 50% of all cases of Lynch syndrome, a hereditary predisposition to colorectal cancer, through varying and...
Resource Type:: Honors College Thesis
Full Text:: ). Colonies were fixed and stained by aspirating media and washing with 6% ethanol and 0.28% w/v methylene

Aging and oxidative damage to mitochondrial membrane proteins

Creator:: Tong, Tony T.
Abstract:: Mitochondria provide energy for biological cells to function, but this process is also a source of oxygen radicals that are capable of damaging nearby proteins. Mitochondrial protein damage can eventually lead to cell death, especially in the case of heart cells, where mitochondria are present in the highest concentrations. As...
Resource Type:: Honors College Thesis
Full Text:: for 10 min at 4˚C, and then 8 µL of sample buffer (0.5 M aminocaproic acid, 50 mM BisTris, 5% w/v

Poster and Presentation Abstracts : 7th Biennial Conference on University Education in Natural Resources

Creator:: 7th Biennial Conference on University Education in Natural Resources and Biennial Conference on University Education in Natural Resources
Abstract:: List of abstracts for posters and papers presented at the 7th Biennial Conference on University Education in Natural Resources, held March 13-15 2008 at Oregon State University. Contact the author(s) for more information on papers is listed here for which no entry appears in the conference collection at: http://ir.library.oregonstate.edu/dspace/handle/1957/7138
Resource Type:: Conference Proceeding
Full Text:: of Fisheries and Wildlife, Oregon State University Co-Authors: W. Daniel Edge, and Judith Li

Perceptual thresholds for foot slipping in animated characters

Creator:: Strawn, Jordan J.
Abstract:: The computer game industry continues to progress toward realistic-looking character motion. However, even in state-of-the-art games, the use of motion capture data in character animation may result in errors such as “foot slipping,” where the feet do not match up with the floor properly during translation. Various algorithms have been...
Resource Type:: Honors College Thesis
Full Text:: parents, W. Gregg and Pam Strawn, for participating in the pilot study and for many years of love and

Exploring phylogeny of Rhodococcus fascians isolates using 16S ribosomal DNA sequence analysis

Creator:: Sandberg, Eva Song
Abstract:: Rhodococcus fascians is a Gram-positive, pleiomorphic actinomycete that causes leafy gall formation in a wide range of plant hosts. This particular phytopathogen has been a focus of research at the Oregon State University Plant Clinic, a diagnostic laboratory. Phylogeny of R. fascians isolates obtained from Plant Clinic submissions was determined...
Resource Type:: Honors College Thesis
Full Text:: /research/bioinformatics/FAQ/bootstrap.shtml> 3. Crespi, M., D. Vereecke, W. Temmerman, and M. Van Montagu

A Java implementation of the elliptic curve digital signature algorithm using NIST curves over GF(p)

Creator:: Stadick, Rhea
Abstract:: The Elliptic Curve Digital Signature Algorithm (ECDSA) is a public key cryptosystem used for creation and verification of digital signatures in electronic documents. In this thesis, we created a Java applet that provides the functionality of the ECDSA using all of the NIST elliptic curves over GF(p). This applet was...
Resource Type:: Honors College Thesis
Full Text:: field, F(2k), referred to as a binary field, contains 2k elements for the degree k of the field. Bit

Location of the neutral axis in wood beams

Creator:: Holm, Sarah C.
Abstract:: It is commonly accepted that for the analysis of wood beams, the neutral axis coincides with the centroid of the beam. Although this assumption is used in analysis, wood is not an isotropic material, as it has different elastic properties in the tangential, radial and longitudinal directions, nor is it...
Resource Type:: Honors College Thesis
Full Text:: the object must be aligned with the f-stop of the camera to ensure accurate image correlation. The

Ethnic minorities in Oregon: an annotated bibliography

Creator:: Wilkinson, Richenda
Abstract:: This bibliography focuses on works that will provide the reader with supplemental resources on the history of ethnic minorities in Oregon. An effort has been made to highlight materials that are particularly appropriate for use in teaching students of various ages. The featured resources address all historical time periods, but...
Resource Type:: Part of Book
Full Text:: . Slatta, Richard W. "Chicanos in the Pacific Northwest: An Historical Overview of Oregon's Chicanos

Usability Testing to Improve a Teaching Website for Graduate Counselor Education Students

Creator:: McMillen, Paula S., Pehrsson, Dale Elizabeth, and Lin, Shao-Chen
Abstract:: Expectations for technology proficiency in counseling and counselor education have increased; nevertheless, very little information is available in the counseling literature which describes how to effectively evaluate online resources from a design and utility standpoint. This study provides a model for such assessments, employing an affordable small scale usability study...
Resource Type:: Article
Full Text:: . Retrieved April 2, 2007 from http://jtc.colstate.edu/vol2_2/baggerly/baggerly.htm. Barratt, W. (2001

A bibliotherapy evaluation tool: grounding counselors in the therapeutic use of literature

Creator:: Pehrsson, Dale Elizabeth and McMillen, Paula S.
Abstract:: Discusses the development and evolution of the Bibliotherapy Evaluation Tool to help graduate counseling students use literature in therapy ethically and appropriately. A survey of bibliotherapeutic practice in the helping professions is provided. Graduate students showed greater knowledge of and comfort with bibliotherapy after exposure to a teaching module and...
Resource Type:: Article and Preprint
Full Text:: are stimulating, and possibilities abound. References Ackerson, J., Scogin, F., McKendree-Smith, N

Teaching writing within Forestry

Creator:: Kolb, Thomas, Friginal, Eric, Lee, Martha Eugenia, Tracy-Ventura, Nicole, and Grieve, Jack
Abstract:: 7th Biennial Conference on University Education in Natural Resources. In 2005 faculty in the Northern Arizona University School of Forestry initiated a project to replace the required sophomore-level writing course taught by the English Department with a new course, “Writing in Forestry,” taught within the School. The goal of the...
Resource Type:: Conference Proceeding
Full Text:: ) laboratory reports, d) memos, e) professional opinion pieces, and f) selected sections of a forest management

Mapping a path to sustainable utilization of bay clam resources in Oregon’s 21st century estuaries : an investigation into the potential of Oregon’s commercial bay clam fishery : Report to the Oregon Department of Fish and Wildlife and the Oregon Commercial Bay Clam Industry

Creator:: Endreny, Polly A. and Sylvia, Gil
Abstract:: This study was commissioned and funded by the Coastal Oregon Marine Experiment Station (COMES) to 1) identify the scientific and management issues constraining the advancement of the Oregon bay clam commercial industry, 2) explore scientific, management, and economic opportunities for the enhancement of the fishery, 3) outline and suggest mechanisms...
Resource Type:: Capstone Project

Biological considerations for a new approach to regulating genetically modified crops in the United States

Creator:: McDonough, Ashley
Abstract:: The debate over GM crops is one of the most controversial issues of recent decades. The debate has many dimensions, including environmental impacts, benefits and risks to human health, intellectual property rights, adequacy of biosafety regulations, and fundamental ethical acceptability. The potential benefits of GM crops are numerous, including improved...
Resource Type:: Honors College Thesis
Full Text:: ., Parrott, W., and Strauss, S.H. 2005. Regulating transgenic crops sensibly: lessons from plant breeding

Beyond free will: an empirical case for a capacity model of human agency

Creator:: Helzer, Erik G.
Abstract:: Although the question of free will has persisted throughout the history of philosophy as an important metaphysical consideration, rarely does the inquiry include empirical evidence from other disciplines concerned with human behavior. In this interdisciplinary paper, I combine the wisdom of psychologists, metaphysicians, and philosophers of science to comment on...
Resource Type:: Honors College Thesis

Investigating the age-related loss of endoplasmic reticulum stress response

Creator:: Fallahi, Anahita
Abstract:: The endoplasmic reticulum (ER) is a crucial organelle in the cell where protein folding and processing occurs, and conditions that negatively affect ER functions are highly detrimental to the cell. The accumulation of unfolded/misfolded proteins in the ER leads to a condition known as ER Stress. The ER has developed...
Resource Type:: Honors College Thesis
Full Text:: (standardized against β actin), at 4, 12, and 16 m R N A N Q O 1/ β- A ct in Pe rc en t o f C

Complex questions, evolving answers: Creating a multidimensional assessment strategy to build support for the “teaching library”

Creator:: McMillen, Paula S. and Deitering, Anne-Marie
Abstract:: Since 2001, librarians at Oregon State University’s Valley Library have been working to build a “teaching library” supported by a clearly articulated instruction program. From the start, we believed that we needed to assess the “teaching library’s” impact, not only to determine the success or failure of our efforts but...
Resource Type:: Article

Studying abroad and vocabulary use in impromptu essays

Creator:: Mitchell, Kathleen
Abstract:: Spending time in a German speaking country may aid in vocabulary acquisition and production. This study hypothesized a concrete link between written language use and experiences abroad. Intermediate German students’ vocabulary uses in impromptu essays were evaluated by counting the number of total word, unique words, and content words. This...
Resource Type:: Honors College Thesis
Full Text:: , 49-55. D’Anna, C. A., Zechmeister, E. B., & Hall, J. W. (1991). Toward a meaningful definition of

Patterns of age and growth in young-of-year rockfish, sebastes spp., along the Oregon coast

Creator:: Young, Thomas
Abstract:: Rockfish of the genus Sebastes are important components of Oregon reef communities. I examined patterns of age and growth in young-of-year rockfish across two nested spatial scales – local and regional – along the Oregon coast. Using otolith microstructural examination, I examined the relative importance of local versus regional factors...
Resource Type:: Honors College Thesis
Full Text:: -somatic growth relationships for lengths……………………122 Figure F. Length-age relationships

Entrapment of Micro-Algae in Modified Alginate Beads for Oxygen and Nutrient Source

Creator:: Hughson, Jason D.
Abstract:: Presented here is an investigation and comparison of two entrapment methods of algae. Conventional calcium alginate bead entrapment is compared to a recently described modified bead entrapment method, utilizing poly(ethylene glycol) and calcium alginate, which results in void or capillary formation within the beads. It is shown that algal growth...
Resource Type:: Honors College Thesis
Full Text:: , Richard J. (1964). Mass culture of microalgae for photosynthetic gas exchange. In Jackson, Daniel F (Ed

Militant and nonviolent social movements

Creator:: Robinson, Blake
Abstract:: While much has been written about why people join social movements in general, little has been written about why people specifically join either militant or nonviolent social movements. Using the Black Panther Party as an example of a militant social movement and the mainstream Civil Rights Movement as an example...
Resource Type:: Honors College Thesis

Sexual dimorphism and seasonal changes in the Harderian gland of the red-sided garter snake, Thamnophis sirtalis parietalis

Creator:: Erickson, Sten M.
Abstract:: The Harderian gland (HG) of the red-sided garter snake, Thamnophis sirtalis parietalis, is a secretory structure that plays a role in the vomeronasal system by solubilizing semiochemicals such as prey chemoattractants and the female sexual attractiveness pheromone. The HG produces secretions containing pheromone-binding proteins that form a complex with pheromone...
Resource Type:: Honors College Thesis

A critical analysis of the globalization of English in the U.S. and abroad

Creator:: De Lora, Emily
Abstract:: Although thousands of volunteers from the United States go abroad each year to teach English, many are unprepared for their experiences. Undergraduate students teaching in a foreign country seem to lack training in educational methodology or foreign relations that would prepare them for teaching and living abroad. This project was...
Resource Type:: Honors College Thesis

Implementation of a new library/university service: Oregon State University’s Institutional Repository

Creator:: Webster, Janet G., Boock, Michael, Christie, Anne, Landis, Lawrence, Kristick, Laurel, and Frumkin, Jeremy
Abstract:: This report was done by the OSU Libraries Institutional Repository Task Force for the OSU Libraries Administration.
Resource Type:: Technical Report
Full Text:: commitment to cataloging or metadata creation, perpetual storage, and access. 3-f) Need to preserve examples

Asperger’s Syndrome: research and personal insight into characteristics and intervention techniques

Creator:: Rinaldi, David Brian
Abstract:: Through examination of empirical evidence on individuals with Asperger’s Syndrome and related Pervasive Developmental Disorders, the author attempts to provide an overview of the social deficiencies associated with these disorders. Points of primary concern are the social deficiencies in developing competence in experience-sharing and demonstrating empathy, especially in how they...
Resource Type:: Honors College Thesis

Cool hideaways: use of temperature refuges by juvenile coho salmon in the West Fork Smith River

Creator:: Raskauskas, Nancy
Abstract:: The West Fork Smith River, a 69 km2 watershed in the Coast Range of Oregon, is prone to short periods of very high water temperature in mid-summer due to a combination of human and natural influences. In the summers of 2003 and 2004 more than 400 juvenile coho salmon regularly...
Resource Type:: Honors College Thesis

Biodiesel in Oregon : an agricultural perspective

Creator:: Lahmann, Emily Loren
Abstract:: Biodiesel is a renewable, non-toxic, and biodegradable diesel fuel made from agricultural feedstocks. With a vibrant agricultural industry, Oregon is positioned to play an important role in the future of this energy source. Limiting factors to widespread biodiesel production include low value of biodiesel feedstock crops, lack of infrastructure, lagging...
Resource Type:: Honors College Thesis

Habitat monitoring : an approach for reporting status and trends for state comprehensive wildlife conservation strategies

Creator:: Schoonmaker, Peter and Luscombe, Wayne
Abstract:: This paper provides some background information on coarse to medium scale habitat monitoring techniques and proposes a framework for a statewide system. It is designed for state fish and wildlife agencies and their partners to help them meet the monitoring requirement in the development of wildlife strategies.
Resource Type:: Technical Report

The People's band: U2 and international activism

Creator:: Peterson, Maxie Jean
Abstract:: The end of the Cold War brought about changes within international political relations that resulted in expanded interest in global civil society. Such developments, like globalization and democratization, have encouraged the growth of social and political organizations. Political scientists have found that these inter-governmental and non-governmental organizations have a significant...
Resource Type:: Honors College Thesis
Full Text:: , 1985 at John F. Kennedy Stadium in Philadelphia and Wembley Stadium in London. Video clips of

Effects of phenytoin and carbamazepine on calcium transport in Caco-2 cells and pilot study to compare the role of the Chilean and United States pharmacist from the patient perspective

Creator:: von Borstel, Melinda
Abstract:: Adverse effects of anti-epileptic (AED) medications on bone density have been reported since the 1960s. Phenytoin and carbamazepine, two commonly prescribed AED, are frequently associated with osteomalacia including fractures and reduced bone formation. The mechanism by which AED induces bone loss is not fully explained. We sought to determine the...
Resource Type:: Honors College Thesis

Search Constraints

Search Results

Limit your search