Index Catalog // ScholarsArchive@OSU

Creating a Predictive Model of Cinder Cone Evolution in Central Oregon

Creator:: Das-Toke, Shyam P.
Abstract:: Cinder cones are useful geomorphic features for geological analysis because they generally have known initial states and follow a similar pattern of degradation as they are exposed to erosive processes. This is largely because cinder cones are produced by monogenetic eruptions. Characterizing large cinder cone fields in terms of age...
Resource Type:: Masters Thesis
Full Text:: .................................................................................................................. 43 Appendix A: Script in R

What do people think about genetically engineering trees? A qualitative inquiry to understand how people reason about using forest biotechnology to address forest health threats

Creator:: Emery, Elizabeth R.
Abstract:: Climate change is increasing the severity of pest and pathogen infestations affecting forests. Resulting shifts in disturbance patterns can have substantial ecological, social, and economic impacts on forested ecosystems and their dependent communities. Researchers are actively investigating methods to improve tree resistance to specific pests and pathogens and enhance forest...
Resource Type:: Masters Thesis
Full Text:: controversial in agricultural applications (Scott, Inbar, Wirz, Brossard, & Rozin, 2018), it is important to

Pasture Production and Lamb Growth from Dryland Hill Pastures in Western Oregon

Creator:: Gultekin, Yunus
Abstract:: Pasture legumes that persist under challenging agro-ecological conditions are crucial to ensure high lamb growth rates in dryland pastures. Pasture and lamb production from white clover (TF-Whc), birdsfoot trefoil (TF-Bft), balansa clover (TF-Bc) and subterranean clover (TF-Sc) planted with tall fescue either as binary mixtures or as a diverse combination...
Resource Type:: Masters Thesis
Full Text:: pastures, nitrogen fixing ability and high quality animal feed value (Scott, 2003). Nitrogen fixation of

Predicting Protein-Protein Interactions in a Cnidarian Model System

Creator:: Gregory, Dylan B.
Abstract:: The symbiotic sea anemone Exaiptasia diaphana (Aiptasia) is a model organism used to better understand cnidarian-algal symbiosis and coral bleaching (dysbiosis). Many biological processes are hypothesized to be involved in coral dysbiosis, and the innate immunity is a key area of interest. Rab proteins are small proteins with GTPase domains,...
Resource Type:: Honors College Thesis
Full Text:: ATGAGATTTTTGATGGAGATAAAG OCRL-R CATAATGCAAACGGCTTG Rab5-F ACTGAACCTTTGGAACGAGTC Rab5-R GGAAGCACCTGAGTAC Rab7-F

The Role of Facilitation for Maintaining Key Processes of Sagebrush-steppe Plant Populations in a Changing Climate

Creator:: Weisgerber, Elizabeth K.
Abstract:: Drought events have been shown to impact species distributions and are predicted to increase in frequency as the climate changes. As this occurs, ecologists predict species distributions will shift dependent upon species ability to track climate. These shifts in species distribution are expected to be particularly acute in arid and...
Resource Type:: Dissertation
Full Text:: Invasions, 17(1), 73–85. Scott, R. L., Cable, W. L., & Hultine, K. R. (2008). The ecohydrologic

Drone Strikes : The Moral, Political, and Legal Implications of the Changing Character of War

Creator:: Khalife, Ryan A.
Abstract:: Drone strikes have become a defining strategy in the US War on Terror. Since the first combat drone strike in 2001, the executive branch has intentionally increased the deployment of drones for counterterrorism operations throughout the Middle East and North Africa. This thesis explores the moral and legal justifications for...
Resource Type:: Honors College Thesis

An Interdisciplinary-Botanical Perspective for Cultural Resource Management: A Definition and the Application of Culturally Significant Plants in Identification, Interpretation, and Evaluation for the National Register of Historic Places

Creator:: Burk, Rene F.
Abstract:: Cultivated plants are often living artifacts that can aid in evaluation of historic or cultural landscapes. However, a working definition for “culturally significant plant” is currently lacking in the guidance literature for the cultural resource management practitioners. Based on a review of the literature on cultivated plants as indicators of...
Resource Type:: Masters Thesis

Computational Approaches for Understanding Combinatorial Gene Regulation

Creator:: Ansariola, Mitra
Abstract:: Gene regulation is a complex mechanism that controls the spatial and temporal expression of genes in a living cell. My dissertation studies focus on two problems. First, tissue-specific gene expression prediction from DNA sequence and chromatin state, and second, the accurate discovery of small over-represented regulatory circuits in gene regulatory...
Resource Type:: Dissertation
Full Text:: sequence R = C = {2, 1, 1, 2, 1, 1}. . . . 73 3.13 An illustrative view of graph sampling strategy

Investigating the Mechanisms for the Effects of Nitrate Treatment on Exercise Performance and Energy Metabolism

Creator:: Keller, Rosa M.
Abstract:: Dietary nitrate (NO3-), consumed primarily from leafy green and root vegetables, lowers blood pressure, improves vascular function and aerobic exercise performance. This performance-enhancing effect of nitrate supplementation is largely attributed to the increased bioavailability of the signaling molecule, nitric oxide (NO). Nitric oxide is a ubiquitous free radical signaling molecule...
Resource Type:: Dissertation
Full Text:: , RM; Beaver, LM; Reardon, R; Prater, MC; Truong, L; Robinson, MM; Tanguay, RL; Stevens, JF; Hord, NG

Investigating Transcriptional Control of Specialized Gene Expression in Plants

Creator:: Fraser, Valerie N.
Abstract:: Specialized or secondary metabolism is a collection of pathways and small molecules that, while beneficial to an organism, are not strictly necessary for survival. Plants use secondary metabolites to, among other things, attract pollinators, defend against biotic and abiotic stressors, and form symbioses. Natural products from plants have seen an...
Resource Type:: Dissertation
Full Text:: . Filichkin, Maria G. Ivanchenko, Zachary A. Bright, Russell A. Gould, Olivia R. Ozguc, Shawn T. O’Neil

ScholarsArchive@OSU

Creating a Predictive Model of Cinder Cone Evolution in Central Oregon

What do people think about genetically engineering trees? A qualitative inquiry to understand how people reason about using forest biotechnology to address forest health threats

Pasture Production and Lamb Growth from Dryland Hill Pastures in Western Oregon

Predicting Protein-Protein Interactions in a Cnidarian Model System

The Role of Facilitation for Maintaining Key Processes of Sagebrush-steppe Plant Populations in a Changing Climate

Drone Strikes : The Moral, Political, and Legal Implications of the Changing Character of War

An Interdisciplinary-Botanical Perspective for Cultural Resource Management: A Definition and the Application of Culturally Significant Plants in Identification, Interpretation, and Evaluation for the National Register of Historic Places

Computational Approaches for Understanding Combinatorial Gene Regulation

Investigating the Mechanisms for the Effects of Nitrate Treatment on Exercise Performance and Energy Metabolism

Investigating Transcriptional Control of Specialized Gene Expression in Plants

Limit your search

Academic Affiliation

Advisor

Commencement Year

Committee Member

Creator

Contributor

Date

Decade

Degree Field

Degree Level

Degree Name

Language

License

Non-Academic Affiliation

Peer Reviewed

Resource Type

Rights Statement

Subject

Search Constraints

Search Results

Limit your search